Báo cáo khoa học: "Spontaneous intratumoral bleeding and rupture of giant gastric stromal tumor ( 30 cm) in a young patient" pot

... for citation purposes) World Journal of Surgical Oncology Open Access Case report Spontaneous intratumoral bleeding and rupture of giant gastric stromal tumor (& gt; 30 cm) in a young patient Ruy ... all primarily in elderly patients. We report an unusual case, in which a giant gastric GIST – in a young patient – presented as spontaneous intra...

Ngày tải lên: 09/08/2014, 07:21

... S1 (5 ¢-GCAAATGCAACTGGA AGCGG-3¢)andA 1(5 ¢-ACAGCCTGCTAGCAAAGA GG-3¢) for amplification of HRT1, and primers S2 (5 ¢-GAAGAATCCTCTAAGGATAA-3¢)andA 2(5 ¢-TA CAAGGATTAATCCCTTGC-3¢) for amplification of HRT2. ... AAM92890), AAM92881, AAM92879, BAB92023 (AAM92883, AAM92884, AAM92885, AAM92887, AAM92888), BAB92024 and AAM92882 (AAM92886) (submitted to Genbank TM and DDBJ by Coldre...

Ngày tải lên: 07/03/2014, 21:20

... and Brassica rapa) and vegetables such ase cabbage (Brassica oleraceae var. capitata), cauliflower (B. oleraceae var. botrytis) and broccoli (B. oleraceae Keywords brassinin; cyclobrassinin; detoxification; dithiocarbamate ... molecular mass: Blue dextran (2 000 kDa), apoferritin (4 43 kDa), b-amylase (2 00 kDa), alcohol dehydrogenase (1 50 kDa), albumin (6 7 kDa), ovalbumi...

Ngày tải lên: 18/02/2014, 14:20

... and F. scutaria larvae sequences have a H64 also shared by A. gambiae, A. aegypti, T. gigas, D. melanogaster-2 and D. melanogaster-3 sequences (data not shown). By contrast, R. pachyptila amino acid ... scutaria. Finally, we chose an outgroup comprising a- CAs from a cyanobacteria (Nostoc sp.) and three proteobacteria (Klebsiella pneumo- niae, Erwinia carotovora ssp. atroseptica...

Ngày tải lên: 18/02/2014, 16:20

... pET-22b(+) vector as template, 5¢- TAATACGACTCACTATAGG-3¢ [for the T7 promoter of pET-22b(+) vector] as 5¢-primer and 5¢-TCTCCGTAGG GGAGACAAAAGT-3¢,5¢-ATCCCGCGGGGGAAACCT CATC-3¢ and 5¢-CTGTTTGGAC GAACGCAAGATG-3¢ as ... and oxidant, (c) incubated for 10 min with 0.1 mm ATP, and (d) concentrated in a SpeedVac centrifuge. After addition of ammonium bicarbonate (pH 8.5) and urea...

Ngày tải lên: 18/02/2014, 17:20

... RT-PCR against the extracted RNA. (A) Lanes 1 and 2, total RNA extract. (B) Lane 1, nucleotide acid marker DL15000 (TaKaRa); Lane 2, FP subunit. (C) Lane 1, nucleotide acid marker DL2000 (TaKaRa); Lane ... bovine heart mito- chondria. Science 277, 60–66. 13 Tsukihara T, Aoyama H, Yamashita E, Tomizaki T, Yamaguchi H, Shinzawa-Itoh K, Nakashima R, Yaono R & Yoshikawa S (1 995) Structu...

Ngày tải lên: 19/02/2014, 02:20

... Plasmid pGEM23S.5 contains a shortened intron (3 80 bp), 26 bp of the 5¢ exon, and 25 bp of the 3¢ exon. Oligo 104 (4 5 nucleotides, TAATACGACTC ACTATAGGGATCGAATTCTGGGTTCAAAACGTAA) contains, in ... [43]; and for Azoarcus pre-tRNA Ile (F) from [44]. Domain–domain interactions in introns B–F are indicated by dashed lines. In (A) , the lightly shaded nucleotides in the L9...

Ngày tải lên: 19/02/2014, 07:20

... example, asparagine to aspartic acid, or glutamine to glutamic acid changes [14]. The a- conotoxins EpI, PnIA, GIC, GID, AnIA and AnIB contain pairs of asparagine residues [5,10,21,23,24] (Table ... course of characterization of native a- conotoxins. Analysis of neuronally active a- conotoxins using HPLC and MS, including identification of post-translational modifications Isola...

Ngày tải lên: 19/02/2014, 12:20

... the University of Illinois and a German Academic Ex- change Service (DAAD) Graduate Research Grant. Julia Hockenmaier is supported by the National Sci- ence Foundation through CAREER award 1053856 and award ... halves are classified separately, and if the maximum anglicism classifier score out of all splits exceeds a target confidence c (= 0.7), the orig- inal word is labeled a...

Ngày tải lên: 19/02/2014, 19:20

...

Ngày tải lên: 20/02/2014, 18:20