Báo cáo khoa học: "Clinical efficacy and problems with CT ly

Báo cáo khoa học: "Clinical efficacy and problems with CT lymphography in identifying the sentinel node in breast cancer" docx

... method, CTLG: CT Lymphography Table 5: Number of lymph vessels leading to Sentinel nodes and the number of Sentinel nodes Single rout and Single node 151(68%) Multi routs and single node 8(4%) Single ... clear enhancing of the lymph nodes in 88% of the patients, while in 5% of the patients identification of the SN was possible on the basis of the CT value...

Ngày tải lên : 09/08/2014, 07:21

6
290
0

Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

... forward2 GACTGTTGCTCATTTGTGGA IL-10 reverse2 GAGGCTAGATACTGCTCGATGT IL-10 forward3 TGATGATTTGGAACCATTATTGAA IL-10 reverse3 CACCTTTTTCCTTCATCTTTTCAT b-Actin forward1 ACTACCTCATGAAGATCCTG b-Actin reverse1 ... gene. The underlined amino acid residues are the signal sequences of the respective genes. The asterisk indicates the residues important for an interaction with the IL-10R/R1...

Ngày tải lên : 20/02/2014, 02:21

8
584
0

Báo cáo khoa học: "Clinical features and therapeutic management of patients admitted to Italian acute hospital psychiatric units: the PERSEO (psychiatric emergency study and epidemiology) survey" pot

... psychiatric inpatients (up to 98% among schizo- phrenics) and 67–75% among outpatients, with 45 and 28% of combination therapies in in- and outpatients being reported, respectively [28-30]. The rates ... participated in the study. Following approval by the Ethics Committees of the participant institutions and obtainment of the patients' written informed consent, a...

Ngày tải lên : 08/08/2014, 23:20

10
396
0

Tài liệu Báo cáo khoa học: Pronounced adipogenesis and increased insulin sensitivity caused by overproduction of prostaglandin D2 in vivo pptx

... washing, the sections were incubated with the biotinylated goat anti- (rabbit IgG) for 30 min (Vector Laboratories, Burlingame, CA, USA), and this was followed by staining with the avidin–biotin–peroxidase ... after delactation. Basal blood was collected from the tail vein (t = 0 min) and immediately measured for glucose, using an Antsense II. Porcine insulin was injected subc...

Ngày tải lên : 16/02/2014, 09:20

10
647
0

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

... addressed further in this study, and the results obtained with the calcium in ux inhibitor, CAI, do not provide conclu- sive data concerning the nature of the calcium increase. Ras-GRF1 and Ras-dependent ... Ser916 inhibiting (Ser916Ala) or mimicking (Ser916Asp ⁄ Glu) phosphorylation did not alter these effects. However, the deletion of amino acids 1–225, including the Ca...

Ngày tải lên : 19/02/2014, 18:20

13
730
0

Báo cáo khoa học: "Grammar Prototyping and Testing with the LinGO Grammar Matrix Customization System" pot

... “main page”) contains some intro- ductory text and hyperlinks to direct the user to other sections of the questionnaire (“subpages”). Each subpage contains a set of related questions that (with ... lexical items in the input string. Other systems that attempt to elicit linguistic in- formation from a user include the Expedition (Mc- Shane and Nirenburg, 2003) and Avenue pro...

Ngày tải lên : 07/03/2014, 22:20

6
564
0

Báo cáo khoa học: Identiﬁcation and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot

... pGex-vector (Amersham-Pharmacia Biotech) and the pRSET vector (invitrogen), respectively. Subsequently, the cDNAs with the GST and His 6 -tags were further cloned into the pBluescript SK – vector. ... kDa instead of the calculated 72 964 Da, we veriﬁed the correctness of the expected initiation methionine by translating the fusion protein GST-XN73 and His 6 -XN73. As c...

Ngày tải lên : 08/03/2014, 08:20

12
507
0

Báo cáo khoa học: "Trace Prediction and Recovery With Unlexicalized PCFGs and Slash Features" pptx

... with the feature expl. LST feature The parent nodes of LST nodes 2 are marked with the feature lst. Complex conjunctions In SBAR constituents starting with an IN and an NN child node (usu- ally indicating ... Normally, the filler node is a sister node of an ancestor node of the trace, i.e. the filler c-commands the trace node, but in case of clausal fillers i...

Ngày tải lên : 17/03/2014, 04:20

8
284
0

Báo cáo khoa học: "Bridging SMT and TM with Translation Recommendation" pdf

... in order to obtain a desired balance. In the basic case, the training example would be marked as in (3). If we label both the training and test sets with this rule, the accuracy of the prediction ... produce the pseudo- source sentences. We train the SVM classiﬁer using the lib- SVM (Chang and Lin, 2001) toolkit. The SVM- training and testing is performed on t...

Ngày tải lên : 23/03/2014, 16:20

9
294
0

Báo cáo khoa học: Identiﬁcation and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus inﬂuenzae pptx

... 4-substituted and conﬁrming the 3-linkages for the galactose residues of the Sial-lNnT unit (Fig. 7). This conﬁrms that a terminal Sial-lNnT unit is linked to the Hep I residue of the LPS inner core in the sialylated ... to the low intensity of the sialylated glycoforms and a high degree of overlap in the b-anomeric region of the spectrum, NMR methods were not succ...

Ngày tải lên : 23/03/2014, 21:21

11
579
0