Báo cáo khoa học: "Lymphatic mapping and sentinel node biopsy in gynecological cancers: a critical review of the literature" pot
Báo cáo khoa học: "Lymphatic mapping and sentinel node biopsy in gynecological cancers: a critical review of the literature" pot
... Although majority of the nodes are located in internal iliac and external iliac areas, nodes have been found in also presacral, parametrial and parar- ectal areas [33]. In a sentinel node study carried ... internal iliac, and 17% in the parametrial areas [35], whereas Lev- enback found 9% of the sentinel nodes in the paraaortic area, 11% in the common i...
Ngày tải lên: 09/08/2014, 07:21
Báo cáo khoa học: "Tree canopy and herb layer transpiration in three Scots pine stands with different stand structures" potx
... plots and the data on sapwood area in the sample trees, stand sapwood area was calculated. Stand sap flow was calcu- lated as the product of average sap flow density and stand ... leaf area and the leaf biomass the leaf area index of these species (LAIpart ) was calculated. The LAI of the herbaceous layer is the sum of the...
Ngày tải lên: 08/08/2014, 14:21
báo cáo khoa học: " Fever, hyperglycaemia and swallowing dysfunction management in acute stroke: A cluster randomised controlled trial of knowledge transfer" pot
... admis- sion, and length of stay For missing data, patient clinical data will be obtained from the TASC database. Patients themselves will already have agreed to allow access to these data as part of the study ... inter-professional (involving all team professionals), and patient-based (offering and refining clinical treatment protocols). Clinical nursing staff at the intervent...
Ngày tải lên: 11/08/2014, 16:20
báo cáo sinh học:" Human resources and the quality of emergency obstetric care in developing countries: a systematic review of the literature" potx
... results. Once the relevant data had been extracted and the studies summarized, the remainder of the analysis was carried out using the data extraction form and the analytical frame- work presented in the ... Lanka and Tanzania [22-35]. Key interventions that were most often absent included assisted vaginal delivery and manual removal of the pla- centa. Among the...
Ngày tải lên: 18/06/2014, 17:20
báo cáo khoa học: " Can one puff really make an adolescent addicted to nicotine? A critical review of the literature" potx
... coding and interpretation of the data In addition to the methodological flaws noted above, several of the studies we reviewed wer e marred by biased coding and interpretation of the data. For exam- ple, ... lifetime and never having smoked again and can become men- tally and physically addicted to nicotine even if they have never smoked a puff. Below, we examine t...
Ngày tải lên: 11/08/2014, 18:20
báo cáo khoa học: " Association mapping and marker-assisted selection of the lettuce dieback resistance gene Tvr1" potx
... CLSM9959.b1_N18.ab1 F - TGCTCAATTACACTCGAACCA 61 1.5 326 R - CTTCATGGAGAGAAATACAAGGTC CLSZ1525 CLSZ1525.b1_J22.ab1 F - GAAGAAACTCATGAATCTGCTCAA 62 3 157-158 R - TTTGCTCAAGAACTCTTAAACCATT Cntg11275 ... development of resistant cultivars. A combination of classical linkage mapping and associa- tion mapping allowed us to pinpoint the location of the resistance gene on chromosom...
Ngày tải lên: 12/08/2014, 03:21
Tài liệu Báo cáo khoa học: "Mood Patterns and Affective Lexicon Access in Weblogs" ppt
... based on the Euclidean measure of their corresponding ANEW usage, using MDS and hi- erarchical clustering respectively. 4.2 Mood and ANEW Association Based on the IG values between moods and ANEW, ... containing the word are similar with the word in the affective scores. In addition, the least likely moods are much differ- ent with the ANEW in the affect measure....
Ngày tải lên: 20/02/2014, 04:20
Báo cáo khoa học: Muramyl-dipeptide-induced mitochondrial proton leak in macrophages is associated with upregulation of uncoupling protein 2 and the production of reactive oxygen and reactive nitrogen species docx
... resistance to viral and bacterial infections, potentiation of anti-tumour activity of macrophages, manipulation of cytokine release and restoration of haematopoiesis [18–20]. The parent molecule of ... the production of ROS in immune cells in a negative feed- back regulatory cycle. Finally, these data suggest the interesting possibility that UCP2 may serve as an an...
Ngày tải lên: 05/03/2014, 23:20
Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot
... acid at each position is the logarithm of the ratio of its frequency in the training set and the background database). As there is a positive and a negative set that both sample well the amino acid space ... is a proline (aggregation breaker). Several other parame- ters are calculated and reported, such as the average a4 v in each hot-spot, the area of th...
Ngày tải lên: 06/03/2014, 00:20
Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx
... perinuclear areas of the cell via its N-ter- minal ABD. In the absence of ligand, AR is localized predominantly in the cytoplasm, and its hinge domain and the LBD are tethered to the C-terminal end of FLNa ... transport of the AR, interacts with the AR DBD–LBD in a ligand-independent manner [77,86,87]. The absence of filamin hampers androgen- induced AR tr...
Ngày tải lên: 07/03/2014, 01:20