Báo cáo khoa học: "Vacuum-assisted breast biopsy: A comparison of 11-gauge and 8-gauge needles in benign breast disease" pptx

Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

... recognized by mAbs A2 and A5 , and amino acid residues 202–206 by mAb C, respectively. For this reason the reduced reactivity of mAbs A2 and A5 with Gly86Asp and Arg84Gln sub- stituted ASA and mAb C with ... reported that a certain mutant of a1 -AT is retained in the ER and degraded by nonpro- teasomal pathways [7]. This mutant could be stabilized by the addition of...

Ngày tải lên: 07/03/2014, 17:20

10 505 0
báo cáo khoa học: "Thick calcification from a GIST of the stomach penetrating into pericolic soft tissue - report of a case" pptx

báo cáo khoa học: "Thick calcification from a GIST of the stomach penetrating into pericolic soft tissue - report of a case" pptx

... gastrointestinal tract: a paradise for acronyms (GUMP, GIST, GANT, and now GIPACT). Implications of c-kit in genesis, and yet another of many emerging roles of the interstitial cell of Cajal in the pathogenesis ... pathogenesis of gastrointestinal disease. Adv Anat Pathol 1999, 6:19-40. 13. Miettinen M, Sarlomo-Rikala M, Lasota J: Gastrointestinal stromal tumours. Ann Chir...

Ngày tải lên: 09/08/2014, 01:24

4 297 0
Báo cáo khoa học: "Association between intratumoral lymphatic microvessel density (LMVD) and clinicopathologic features in endometrial cancer: a retrospective cohort study" pdf

Báo cáo khoa học: "Association between intratumoral lymphatic microvessel density (LMVD) and clinicopathologic features in endometrial cancer: a retrospective cohort study" pdf

... the influence of intratumoral lymphatic microvessel density (LMVD) on survival in endometrial cancer are available. Our aim was to assess the intratumoral LMVD of endometrial carcinomas and to investigate ... surgical staging and evaluation of intratumoral LMVD and other histologic variables. Lymphatic microvessels were identified by immunohistochemical staining using monoclonal...

Ngày tải lên: 09/08/2014, 03:22

7 311 0
báo cáo khoa học: "Boerhaave syndrome as a complication of colonoscopy preparation: a case report" ppt

báo cáo khoa học: "Boerhaave syndrome as a complication of colonoscopy preparation: a case report" ppt

... persistent and slightly increas- ing back pain, which started immediately after vomiting, diagnostic investigations by esophagogastroscopy and CT scan with oral CM easily revealed a Boerhaave per- foration ... Wedemeyer, Johannes Hadem, Niels C Hellige and Camilla Regler. Authors’ contributions NE and JK had the idea of reporting this case. NE was in charge of our patient, an...

Ngày tải lên: 10/08/2014, 22:20

5 399 0
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

... gctttttggcaccaaagccctcggctccatcgg Lys24 to Ala L2 5A L2 5A F gctttttggcaccaaaaaggccggctccatcg Leu25 to Ala G3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg Gly33 to Ala F3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg ... Ala P2 6A P2 6A F cgcaacgactggctgtggcggtaaaaac Pro26 to Ala L6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala 2R > N R37N F gtagcgggctggattaacgcgttgaatt...

Ngày tải lên: 19/02/2014, 17:20

15 532 0
Báo cáo khoa học: Human telomeric G-quadruplex: structures of DNA and RNA sequences ppt

Báo cáo khoa học: Human telomeric G-quadruplex: structures of DNA and RNA sequences ppt

... up–up–down–down core, also called an antiparallel-stranded core in the literature) (Fig. 2C); and (d) two strands across one diagonal are oriented in one direction and the two remaining strands across the ... Virno A, Pagano B, Virgilio A, Di Micco S, Galeone A, Giancola C, Bifulco G, Mayol L & Randa- zzo A (2007) Structural and thermodynamic studies of the interaction o...

Ngày tải lên: 06/03/2014, 09:22

11 480 0
Báo cáo khoa học: The lactate dehydrogenases encoded by the ldh and ldhB genes in Lactococcus lactis exhibit distinct regulation and catalytic properties ) comparative modeling to probe the molecular basis pdf

Báo cáo khoa học: The lactate dehydrogenases encoded by the ldh and ldhB genes in Lactococcus lactis exhibit distinct regulation and catalytic properties ) comparative modeling to probe the molecular basis pdf

... MG1363 and FI9078 were amplified by PCR with primers LdhB1 (5¢-GTAATTATCATAGAGAGTTTTTAGGAG-3¢) and LdhB2 (5¢-CAAATCCTGTTCCAATCACGA-3¢), designed on the basis of available sequences of rlrD and ldhB ... sufficient to sustain the lactate flux. Therefore, there must be an additional factor acting as an inhibitor of LDHB, and the best candidate is intracellular lactate. At an external...

Ngày tải lên: 16/03/2014, 05:20

13 464 0
Báo cáo khoa học: "An Architecture for Dialogue Management, Context Tracking, and Pragmatic Adaptation in Spoken Dialogue Systems" pot

Báo cáo khoa học: "An Architecture for Dialogue Management, Context Tracking, and Pragmatic Adaptation in Spoken Dialogue Systems" pot

... Natural ~ Context 'Language Tracking aterpretation (on Input) Natural Language Generation Dialogue Manager Pragmatic Adaptation (on Input) Back-End " ~ Pragmatic Adaptation ... and translation of natural language interpretations into functional interface languages of back-end systems. Future work includes investigation of issues raised when a human is en...

Ngày tải lên: 17/03/2014, 07:20

8 408 0
Báo cáo khoa học: Evidence for the slow reaction of hypoxia-inducible factor prolyl hydroxylase 2 with oxygen pptx

Báo cáo khoa học: Evidence for the slow reaction of hypoxia-inducible factor prolyl hydroxylase 2 with oxygen pptx

... metal-to-ligand charge transfer band at approximately 520 nm [27]. Substrate binding adjacent to the Fe(II) is proposed to weaken binding of the remaining coordinated water, thus enabling the binding of ... signal was suppressed by presaturating its resonance. Spectra were obtained at 75 s intervals and integrated using absolute intensity scaling to monitor changes in the intensity o...

Ngày tải lên: 23/03/2014, 03:20

11 457 0
Báo cáo khoa học: Differential gene expression profiles of red and green forms of Perilla frutescens leading to comprehensive identification of anthocyanin biosynthetic genes doc

Báo cáo khoa học: Differential gene expression profiles of red and green forms of Perilla frutescens leading to comprehensive identification of anthocyanin biosynthetic genes doc

... (5¢-AAAAAGCAGGCTACATGGTGGTTAAAG TGTATGGTGCAAC-3¢) and GST-1-r (5¢-AGAAAGC TGGGTTTATTTTGGGAGATCCATAACTTTTCTCC-3¢) for the first round of PCR; and attB1 (5¢-GGGGACAAGT TTGTACAAAAAAGCAGGCT-3¢) and attB2 (5¢-GGGG ACCACTTTGTACAAGAAAGCTGGGT-3¢) ... sequences of primers were: GST-0 and GST- R-1 (5¢-GATATGAGGGCATCTAAAAATTATT-3¢) for PfGST1; PfCHI-2 (5¢-CAAAATGTCTGTGACTCAAGT CC-3¢) and CH...

Ngày tải lên: 23/03/2014, 07:20

9 439 1
w