Báo cáo khoa học: "A case of virilization induced by a Krukenberg tumor from gastric cancer" docx

Báo cáo khoa học: "A case of virilization induced by a Krukenberg tumor from gastric cancer" docx

Báo cáo khoa học: "A case of virilization induced by a Krukenberg tumor from gastric cancer" docx

... Hirayama T, Yamada J, Ueda K, Sato M, Okumura M, Shimokama T, Oka Y: Early gastric cancer with Krukenberg tumor and review of cases of intra- mucosal gastric cancers with Krukenberg tumor. J Gastroen- terol ... associated with an extensive gastric adenocarcinoma and Krukenberg tumor in a premenopausal woman. Virilization occurred three months after diagnosis of gas...

Ngày tải lên: 09/08/2014, 07:21

5 305 0
Báo cáo khoa học: "Serial Combination of Rules and Statistics: A Case Study in Czech Tagging" potx

Báo cáo khoa học: "Serial Combination of Rules and Statistics: A Case Study in Czech Tagging" potx

... 4.70% Average 95.16% 53.36% 95.38% 4.58% Table 5: F-measure-based evaluation of the combined tagger, 5-fold cross-validation Word Form Annotator Tagger Mal´e (Small) AAFP1 1A AAFP1 1A organizace ... distinct tags; the size of the set of possible and plausible tags can reach several thousands. Apart from agglutinative languages such as Turkish, Finnish and Hungarian (see e.g. (Hakka...

Ngày tải lên: 08/03/2014, 05:20

8 519 0
Báo cáo khoa học: "mproving models of wood density by including genetic effects: A case study in Douglas-fir" potx

Báo cáo khoa học: "mproving models of wood density by including genetic effects: A case study in Douglas-fir" potx

... model in at least two ways: either as a main factor, as in analysis of vari- ance (ANOVA), or within an interaction term when asso- ciated with another cofactor, such as ring width or cambial age. ... (W), ring cambial age (CA) and genetic identity (provenance P, family F, clone C). In one case (half-sib progeny), an additional geographical variable was added, as samples came from thr...

Ngày tải lên: 08/08/2014, 14:21

10 336 0
báo cáo khoa học: "Isolated angiitis of the central nervous system with tumor-like lesion, mimicking brain malignant glioma: a case report and review of the literature" pdf

báo cáo khoa học: "Isolated angiitis of the central nervous system with tumor-like lesion, mimicking brain malignant glioma: a case report and review of the literature" pdf

... was obtained from the patient for publication of this Case report and any accompany- ing images. A copy of the written consent is available for review by the Editor-in-Chief of this journal. Author ... 29:627-631. 9. Carandang C, Grant A: Delirium and Isolated Angiitis of the Central Nervous System: a Case Report and Review. CNS Spectrums 2008, 13:209-213. 10. Ozawa T, Sa...

Ngày tải lên: 09/08/2014, 02:20

4 333 0
Tài liệu Báo cáo khoa học: Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects Implications for a mechanism linking obesity and type 2 diabetes pdf

Tài liệu Báo cáo khoa học: Metabolic control of mitochondrial properties by adenine nucleotide translocator determines palmitoyl-CoA effects Implications for a mechanism linking obesity and type 2 diabetes pdf

... P 1 ,P 5 -di(adenosine-5¢)-pentaphosphate (Ap 5A) as inhibitor of adenylate kinase to prevent depletion of available ATP and ADP and to maintain steady-state respiration. Instead, we did a theoretical calculation of the extramitochondrial ... dicarboxylate carrier and sub- strate dehydrogenases (malate and NADH dehydrogenases in the case of glutamate plus malate oxidation, or succ...

Ngày tải lên: 19/02/2014, 05:20

15 547 0
Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

... 12 0A PTH analyser. Synthesis of cDNA Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. It was treated with RNAase-free DNAase I (Pharmacia) ... have approximately the same Table 1. Primer sequences. Primer (5¢fi3¢) Corresponding peptide AS1 GGTTGCCTGAGRTGYATHTG a GCLRCIC AS3 GGGCTATTGGTCAGACGCTACACTC GYWSDATL AS3R GAGTGTAGCGTCTGACCAA...

Ngày tải lên: 19/02/2014, 12:20

6 738 0
Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt

Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt

... Dynamic model-theoretic semantics allows the evaluation of a formula to cause the addition of information to the model. This interaction of the evaluation of a formula and the expansion of ... semantics provides a computationally attractive means of representing the semantics of natural language. However, the models used in this formalism are static and are usually...

Ngày tải lên: 21/02/2014, 20:20

3 394 0
Báo cáo khoa học: Biological role of bacterial inclusion bodies: a model for amyloid aggregation potx

Báo cáo khoa học: Biological role of bacterial inclusion bodies: a model for amyloid aggregation potx

... of Trigonopsis variabilis D-amino acid oxidase and fast comparison of the operational stabilities of free and immobilized preparations of the enzyme. Biotechnol Bioeng 99, 251–260. 36 Nahalka J & Patoprsty ... Garcı ´ a- Fruito ´ s E, Gonzalez-Montalban N, Morell M, Vera A, Ferraz RM, Aris A, Ventura S & Villaverde A (2005) Aggregation as bacterial inclusion bodies does n...

Ngày tải lên: 06/03/2014, 00:20

9 432 0
Báo cáo khoa học: Functional implications of pigments bound to a cyanobacterial cytochrome b6f complex potx

Báo cáo khoa học: Functional implications of pigments bound to a cyanobacterial cytochrome b6f complex potx

... small positive and negative features around 630 and 620 nm, respectively, as well as a sharp negative feature at 555 nm and pos- itive features near 548 and 530 nm. These data indicate negative ... City, CA, USA) 12 that was run at a flow rate of 7 mLÆmin )1 at 10 °C. Upon applying a decreasing ammonium sulfate gra- dient, the cyt b 6 f complex eluted at a concentration of about 1...

Ngày tải lên: 07/03/2014, 16:20

11 520 0
Báo cáo khoa học: The binding of IMP to Ribonuclease A pptx

Báo cáo khoa học: The binding of IMP to Ribonuclease A pptx

... Thus, although the Table 4. Van der Waals interactions of IMP and AMP in the active site of RNase A. IMP ⁄ AMP atom RNase A IMP RNase A AMP IMP Mol I IMP Mol II IMP Mol III RNase A Mol A RNase A ... binding of purines. In addi- tion, Cys65 Sc and Ala109 Cb are within van der Waals contact distance of the base. The functional role of Gln69, Asn71 and Glu111 has been analyse...

Ngày tải lên: 07/03/2014, 21:20

14 360 0
Từ khóa:
w