Báo cáo khoa học: "A case of virilization induced by a Krukenberg tumor from gastric cancer" docx

... Hirayama T, Yamada J, Ueda K, Sato M, Okumura M, Shimokama T, Oka Y: Early gastric cancer with Krukenberg tumor and review of cases of intra- mucosal gastric cancers with Krukenberg tumor. J Gastroen- terol ... associated with an extensive gastric adenocarcinoma and Krukenberg tumor in a premenopausal woman. Virilization occurred three months after diagnosis of gas...

Ngày tải lên: 09/08/2014, 07:21

... 4.70% Average 95.16% 53.36% 95.38% 4.58% Table 5: F-measure-based evaluation of the combined tagger, 5-fold cross-validation Word Form Annotator Tagger Mal´e (Small) AAFP1 1A AAFP1 1A organizace ... distinct tags; the size of the set of possible and plausible tags can reach several thousands. Apart from agglutinative languages such as Turkish, Finnish and Hungarian (see e.g. (Hakka...

Ngày tải lên: 08/03/2014, 05:20

... model in at least two ways: either as a main factor, as in analysis of vari- ance (ANOVA), or within an interaction term when asso- ciated with another cofactor, such as ring width or cambial age. ... (W), ring cambial age (CA) and genetic identity (provenance P, family F, clone C). In one case (half-sib progeny), an additional geographical variable was added, as samples came from thr...

Ngày tải lên: 08/08/2014, 14:21

... was obtained from the patient for publication of this Case report and any accompany- ing images. A copy of the written consent is available for review by the Editor-in-Chief of this journal. Author ... 29:627-631. 9. Carandang C, Grant A: Delirium and Isolated Angiitis of the Central Nervous System: a Case Report and Review. CNS Spectrums 2008, 13:209-213. 10. Ozawa T, Sa...

Ngày tải lên: 09/08/2014, 02:20

... P 1 ,P 5 -di(adenosine-5¢)-pentaphosphate (Ap 5A) as inhibitor of adenylate kinase to prevent depletion of available ATP and ADP and to maintain steady-state respiration. Instead, we did a theoretical calculation of the extramitochondrial ... dicarboxylate carrier and sub- strate dehydrogenases (malate and NADH dehydrogenases in the case of glutamate plus malate oxidation, or succ...

Ngày tải lên: 19/02/2014, 05:20

... 12 0A PTH analyser. Synthesis of cDNA Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. It was treated with RNAase-free DNAase I (Pharmacia) ... have approximately the same Table 1. Primer sequences. Primer (5¢fi3¢) Corresponding peptide AS1 GGTTGCCTGAGRTGYATHTG a GCLRCIC AS3 GGGCTATTGGTCAGACGCTACACTC GYWSDATL AS3R GAGTGTAGCGTCTGACCAA...

Ngày tải lên: 19/02/2014, 12:20

... Dynamic model-theoretic semantics allows the evaluation of a formula to cause the addition of information to the model. This interaction of the evaluation of a formula and the expansion of ... semantics provides a computationally attractive means of representing the semantics of natural language. However, the models used in this formalism are static and are usually...

Ngày tải lên: 21/02/2014, 20:20

... of Trigonopsis variabilis D-amino acid oxidase and fast comparison of the operational stabilities of free and immobilized preparations of the enzyme. Biotechnol Bioeng 99, 251–260. 36 Nahalka J & Patoprsty ... Garcı ´ a- Fruito ´ s E, Gonzalez-Montalban N, Morell M, Vera A, Ferraz RM, Aris A, Ventura S & Villaverde A (2005) Aggregation as bacterial inclusion bodies does n...

Ngày tải lên: 06/03/2014, 00:20

... small positive and negative features around 630 and 620 nm, respectively, as well as a sharp negative feature at 555 nm and pos- itive features near 548 and 530 nm. These data indicate negative ... City, CA, USA) 12 that was run at a flow rate of 7 mLÆmin )1 at 10 °C. Upon applying a decreasing ammonium sulfate gra- dient, the cyt b 6 f complex eluted at a concentration of about 1...

Ngày tải lên: 07/03/2014, 16:20

... Thus, although the Table 4. Van der Waals interactions of IMP and AMP in the active site of RNase A. IMP ⁄ AMP atom RNase A IMP RNase A AMP IMP Mol I IMP Mol II IMP Mol III RNase A Mol A RNase A ... binding of purines. In addi- tion, Cys65 Sc and Ala109 Cb are within van der Waals contact distance of the base. The functional role of Gln69, Asn71 and Glu111 has been analyse...

Ngày tải lên: 07/03/2014, 21:20