Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps
Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps
... GAAAGTTTTAACACTGGAAACTGCAA SNP9 allele1 VIC-TTTTGGTAGCCCTCTC-MGBSNP9R TTACACTTTCTGCAACAGAAAGTAAGC SNP9 allele2 FAM-TTTTGGTATCCCTCTCC-MGBSNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGBSNP11R ... FAM-CACTTATCTGTAGAGCTT-MGBSNP4F CTGGCAATTCTGCCTTGTTTCAG SNP4 allele1VIC- CCGAAGATAAAAGAATC-MGBSNP4R GGATTACAGCCGTGAGCCA SNP4 allele2 FAM- CGAAGATAGAAGAATC-MGBSNP5F AAGCTGAGGCAGGAAGATCAC SNP5 allele1 ... Ger-many [34], and asthma in Japanese [35]. It was likely that haplotype S03 of the IL18 gene was associated with atopicdisorders, typical of Th2-dominant disease. On the other hand, Japanese patients...
- 9
- 559
- 0
Báo cáo y học: "A functional variant of Fcγ receptor IIIA is associated with rheumatoid arthritis in individuals who are positive for anti-glucose-6-phosphate isomerase antibodies" doc
... arthritis (RA) is a heterogeneous autoimmune dis-ease that is characterized by chronic inflammatory polyarthritis[1]. One of the characteristic features of RA is the expression of several autoantibodies. ... was supported in part by the Japanese Ministry of Science and Culture (IM, TS). IM is also a recipient of a fellowship from the Japan Intractable Diseases Research Foundation, Uehara Memorial ... rheumatoid arthritis and 158 healthy Japanese individuals. The horizontal and verti-cal dotted lines represent the cutoff optical density values calculated from ELISA reactions of 158 healthy individuals...
- 6
- 414
- 0
Báo cáo y học: "A Randomized Study of Epithelial Ovarian Cancer: Is Chemotherapy Useful after Complete Remission"
... Bolis G, et al. Impact of Adjuvant Chemotherapy and Surgical Staging in Early-Stage Ovarian Carcinoma: European Organisation for Research and Treatment of Cancer–Adjuvant ChemoTherapy in Ovarian ... prospective randomized comparison of 6 and 12 cycles of Cyclophosphamide, Adriamycin and Cisplatin in advanced epithelial ovarian cancer: a Danish ovarian study Group Trial (DACOVA). Gynecol Oncol 1993;49:30-36. ... Oncologico, in Aviano, for 13 years. He is actively involved in various areas of research, in the past as a member of the Gynaecological Cancer Group of the European Organization for Research and Treatment...
- 10
- 420
- 0
Báo cáo y học: " A comparative analysis of HIV drug resistance interpretation based on short reverse transcriptase sequences versus full sequences" pps
... study, performed the analysis and prepared the manuscript.MB assisted in drafting the manuscript. EvC and KvdB performed the analysis. BW took care of the statistical analysis. WS, CW and TRdW and ... Geneva:WHO; 2009.7. Chaiwarith R, Wachirakaphan C, Kotarathititum W, Praparatanaphan J,Sirisanthana T, Supparatpinyo K: Sensitivity and specificity of using CD4+measurement and clinical evaluation ... cold-chain transport and deep frozen storage is still a challenge in many places. Therefore, the ART -A team is currently investigating the feasibility of using driedblood spots as a source material...
- 9
- 366
- 0
báo cáo khoa học: "Autonomous growth potential of leukemia blast cells is associated with poor prognosis in human acute leukemias" ppt
... participated in the design of the study and research coordination. EW car-ried out research data and statistics analysis and drafted the manuscript. XG participated in animal experiments.AJ participated ... relapse, may engraft and grow in the laterstages of disease, suggesting that the ability of leukemia cells for engraftment and proliferation wasgradually acquired following the process of leukemia ... potential. They also treated the animals with sublethal irradiation (250 cGy of total body irradiation)24 hours before IV injection of leukemic cells. All thesefactors may influence and increase the...
- 10
- 235
- 0
báo cáo khoa học: "Best linear unbiased prediction when error vector is correlated with other random vectors in the model" pptx
... constant,Differentiating these equations with respect to 13 and u and equating to 0 gives(3.2). A similar result can be obtained using a Bayesian approach.V. An exampleSuppose that in ... that in dairy cattle there is a positive covariance between the genetic value of a bull and the residual effects associated with each daughter production record. Taketen ... University,Ithaca, New York 14850 USASummaryNon-zero covariances between random factors of a linear model with the residual or errorvector can be handled with best linear unbiased...
- 6
- 307
- 0
Báo cáo y học: "A severe coarctation of aorta in a 52-year-old male: a case report"
... 1 Ascending aortography Figure 2 Descending aortography Discussion Aortic coarctation is a congenital vascular lesion typically diagnosed in early life, accounting for 5 to 10% of all ... survival depend o n th e disease severity and patient’s age at the time of cor-rection. Death in these patients is usually due to heart failure, coronary artery disease, aortic rup-ture/dissection, ... Highly effective compensatory mechanisms in a 76-year-old man with a coarctation of the aorta. Cardiology 1999, 92:284-286. 8. Bauer M, Alexi-Meskishvili V, Bauer U. Benefits of surgical repair...
- 2
- 487
- 0
Báo cáo y học: "A pilot study of rizatriptan and visually-induced motion sickness in migraineu"
... complaints met criteria for the diagnosis of migrain-ous vertigo. Patients with migraine with aura had significantly more migraine attacks associated with vestibular complaints always (15% ... study, using a small number of subjects, we addressed the hypotheses that rizatriptan acts as a protective agent against visually-induced motion sickness in migraineurs and that rizatriptan interferes ... widely available. Conclusions These pilot data suggest that rizatriptan may in- terfere with the potentiation of visually-induced mo-tion sickness in migraineurs by cranial pain. Ri-zatriptan...
- 6
- 504
- 0
Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"
... evaluated systematically. In this study we therefore aimed at analyzing antibody responses against S. aureus whole cell lysate and its cell wall antigens in patients with deep-seated and Int. ... organism, has the capacity to establish infections in a wide range of body sites. The infections caused by this species are often acute and pyogenic and, if untreated may spread to surrounding ... can be detected in the vast majority of patients with S. aureus invasive infections [12, 13]. Many of these studies have demonstrated the rise in titer of antibodies against TA and PG during...
- 8
- 524
- 2
Báo cáo Y học: A novel gain-of-function mutation of the integrin a2 VWFA domain docx
... may also be centralto the interaction of E-cadherin with the a2 VWFA domain. The availability of the a2 -E318W mutant will greatlyfacilitate the mapping of the integrin binding sites oncollagen ... The substitution of a tryptophan at position F302 in aM led toan increase in ligand binding, increased binding of anantibody associated with aMb2 activation, and a n increase in the proportion of active integrin ... to the VWFA domain by a similar mechanism t o collagen I. Thesedata indicate that residue E318 plays a novel and importantrole in mod ulating a2 VWFA domain–ligand b inding andmay b e involved...
- 9
- 471
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyena new technique of buried absorbable wound closure associated with excellent cosmesis for wounds under tensioni groenning ba hildebrandt pr et al 2003 the influence of age sex and other variables on the plasma level of n terminal pro brain natriuretic peptide in a large sample of the general population heart 89 745 751ahn j h song s k choi y d lee j s 2003 expression of an expansin gene is correlated with root elongation in soybean plant physiology 131 pp 985 997κb target gene signature co regulated by ezh2 rela and relb discriminates basal vs luminal subtype of breast cancers and is associated with poor disease outcomebáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ