Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps

Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps

Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps

... GAAAGTTTTAACACTGGAAACTGCAA SNP9 allele1 VIC-TTTTGGTAGCCCTCTC-MGB SNP9R TTACACTTTCTGCAACAGAAAGTAAGC SNP9 allele2 FAM-TTTTGGTATCCCTCTCC-MGB SNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGB SNP11R ... FAM-CACTTATCTGTAGAGCTT-MGB SNP4F CTGGCAATTCTGCCTTGTTTCAG SNP4 allele1VIC- CCGAAGATAAAAGAATC-MGB SNP4R GGATTACAGCCGTGAGCCA SNP4 allele2 FAM- CGAAGATAGAAGAATC-MGB SNP5F AAGCTGAGGCAGGAAGAT...

Ngày tải lên: 09/08/2014, 07:20

9 559 0
Báo cáo y học: "A functional variant of Fcγ receptor IIIA is associated with rheumatoid arthritis in individuals who are positive for anti-glucose-6-phosphate isomerase antibodies" doc

Báo cáo y học: "A functional variant of Fcγ receptor IIIA is associated with rheumatoid arthritis in individuals who are positive for anti-glucose-6-phosphate isomerase antibodies" doc

... arthritis (RA) is a heterogeneous autoimmune dis- ease that is characterized by chronic inflammatory polyarthritis [1]. One of the characteristic features of RA is the expression of several autoantibodies. ... was supported in part by the Japanese Ministry of Science and Culture (IM, TS). IM is also a recipient of a fellowship from the Japan Intractable...

Ngày tải lên: 09/08/2014, 07:20

6 414 0
Báo cáo y học: "A Randomized Study of Epithelial Ovarian Cancer: Is Chemotherapy Useful after Complete Remission"

Báo cáo y học: "A Randomized Study of Epithelial Ovarian Cancer: Is Chemotherapy Useful after Complete Remission"

... Bolis G, et al. Impact of Adjuvant Chemotherapy and Surgical Staging in Early- Stage Ovarian Carcinoma: European Organisation for Research and Treatment of Cancer–Adjuvant ChemoTherapy in Ovarian ... prospective randomized comparison of 6 and 12 cycles of Cyclophosphamide, Adriamycin and Cisplatin in advanced epithelial ovarian cancer: a Danish ovarian study Group Trial (DA...

Ngày tải lên: 03/11/2012, 09:57

10 420 0
Báo cáo y học: " A comparative analysis of HIV drug resistance interpretation based on short reverse transcriptase sequences versus full sequences" pps

Báo cáo y học: " A comparative analysis of HIV drug resistance interpretation based on short reverse transcriptase sequences versus full sequences" pps

... study, performed the analysis and prepared the manuscript. MB assisted in drafting the manuscript. EvC and KvdB performed the analysis. BW took care of the statistical analysis. WS, CW and TRdW and ... Geneva: WHO; 2009. 7. Chaiwarith R, Wachirakaphan C, Kotarathititum W, Praparatanaphan J, Sirisanthana T, Supparatpinyo K: Sensitivity and specificity of using CD4+ measurement...

Ngày tải lên: 10/08/2014, 05:21

9 366 0
báo cáo khoa học: "Autonomous growth potential of leukemia blast cells is associated with poor prognosis in human acute leukemias" ppt

báo cáo khoa học: "Autonomous growth potential of leukemia blast cells is associated with poor prognosis in human acute leukemias" ppt

... participated in the design of the study and research coordination. EW car- ried out research data and statistics analysis and drafted the manuscript. XG participated in animal experiments. AJ participated ... relapse, may engraft and grow in the later stages of disease, suggesting that the ability of leukemia cells for engraftment and proliferation was gradually acquired...

Ngày tải lên: 10/08/2014, 22:20

10 235 0
báo cáo khoa học: "Best linear unbiased prediction when error vector is correlated with other random vectors in the model" pptx

báo cáo khoa học: "Best linear unbiased prediction when error vector is correlated with other random vectors in the model" pptx

... constant, Differentiating these equations with respect to 13 and u and equating to 0 gives (3.2). A similar result can be obtained using a Bayesian approach. V. An example Suppose that in ... that in dairy cattle there is a positive covariance between the genetic value of a bull and the residual effects associated with each daughte...

Ngày tải lên: 09/08/2014, 22:23

6 307 0
Báo cáo y học: "A severe coarctation of aorta in a 52-year-old male: a case report"

Báo cáo y học: "A severe coarctation of aorta in a 52-year-old male: a case report"

... 1 Ascending aortography Figure 2 Descending aortography Discussion Aortic coarctation is a congenital vascular lesion typically diagnosed in early life, accounting for 5 to 10% of all ... survival depend o n th e disease severity and patient’s age at the time of cor- rection. Death in these patients is usually due to heart failure, coronary artery disease, aortic...

Ngày tải lên: 25/10/2012, 11:40

2 488 0
Báo cáo y học: "A pilot study of rizatriptan and visually-induced motion sickness in migraineu"

Báo cáo y học: "A pilot study of rizatriptan and visually-induced motion sickness in migraineu"

... complaints met criteria for the diagnosis of migrain- ous vertigo. Patients with migraine with aura had significantly more migraine attacks associated with vestibular complaints always (15% ... study, using a small number of subjects, we addressed the hypotheses that rizatriptan acts as a protective agent against visually-induced motion sickness in migraineurs and...

Ngày tải lên: 26/10/2012, 09:57

6 504 0
Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

... evaluated systematically. In this study we therefore aimed at analyzing antibody responses against S. aureus whole cell lysate and its cell wall antigens in patients with deep-seated and Int. ... organism, has the capacity to establish infections in a wide range of body sites. The infections caused by this species are often acute and pyogenic and, if untreated may sprea...

Ngày tải lên: 02/11/2012, 11:08

8 525 2
Báo cáo Y học: A novel gain-of-function mutation of the integrin a2 VWFA domain docx

Báo cáo Y học: A novel gain-of-function mutation of the integrin a2 VWFA domain docx

... may also be central to the interaction of E-cadherin with the a2 VWFA domain. The availability of the a2 -E318W mutant will greatly facilitate the mapping of the integrin binding sites on collagen ... The substitution of a tryptophan at position F302 in aM led to an increase in ligand binding, increased binding of an antibody associated with aMb2 activati...

Ngày tải lên: 08/03/2014, 22:20

9 471 0
w