Báo cáo y học: " Functional inhibition of NF-κB signal transduction in αvβ3 integrin expressing endothelial cells by using RGD-PEG-modified adenovirus with a mutant IκB gene" ppsx
Tài liệu Báo cáo Y học: Functional analysis of DM64, an antimyotoxic protein with immunoglobulin-like structure from Didelphis marsupialis serum pdf
... sequence, was compared with sequences in the GenBank database using BLASTSearchProgram (NCBI, Bethesda, MD).Myotoxicity in vivoMyotoxicity was analyzed by quantification of plasmacreatine kinase ... (M13F-cccagtcacgacgttgtaaaacg- and M13R-agcggataacaatttcacacagg) were fromLife Technologies, Inc. All other chemicals were of analy-tical grade or higher quality.Animals, venoms, and toxinsD. marsupialis ... phenylalanine and tyrosine typical of the Ig-fold are bold in each domain.Fig. 5. Inhibition of in vivo myotoxicity of myotoxins I or II by DM64.Groups of four mice were injected intramuscularly...
- 11
- 620
- 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... 2002 Small heat shock /a- crystallin protein from Artemia (Eur. J. Biochem. 269) 937 Functional analysis of a small heat shock /a- crystallin proteinfromArtemia franciscanaOligomerization and thermotoleranceJulie ... thermotoleranceJulie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRaeDepartment of Biology, Dalhousie University, Halifax, Nova Scotia, CanadaOviparously developing embryos of the brine shrimp,Artemia ... S .A. ( 1999) Adaptive signifi-canceofasmallheatshock /a- crystallin protein (p26) in encystedembryos of the brine s hrimp, Artemia franciscana. Am. Zool. 39,836–847.49. Liang, P. & MacRae,...
- 10
- 495
- 0
Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot
... purified by immobilized metal ion a nity (A) or immunoaffinity chromatography using anti-histidine Igs (B). Results were analysed by Western blot as in Fig. 1, or by autoradiography of 35S-labelled ... purification, a recombinant versionwas made containing a C-terminal myc tag followed by a His6sequence, by cloning the CCR5 gene into a pcDNA3.1myc-his vector, and transfecting CHO cells with ... quantitativelyretained on the column, and could be eluted with imidazole.The protein was unidentifiable by autoradiography in celllysates, but appeared as the predominant band afterpurification,...
- 12
- 541
- 0
Báo cáo Y học: Functional expression of human liver cytosolic b-glucosidase in Pichia pastoris Insights into its role in the metabolism of dietary glucosides ppt
... a- D-galactopyranoside, a- L-arabinopyranoside,b-L-arabinopyranoside, a- L-arabino-furanoside, a- D-man-nopyranoside, a- D-mannopyranoside, a- D-fucopyranoside, a- D-xylopyranoside, a- L-rhamnopyranoside) ... beta-glucosi-dase. Patent WO 99/03874.36. Yahata, K., Mori, K., Arai, H., Koide, S., Ogawa, Y. , Mukoyama,M.,Sugawara ,A. ,Ozaki,S.,Tanaka,I.,Nabeshima ,Y. &Nakao,K. (2000) Molecular c loning and e ... The crystal structures of Sinapis alba myro-sinase and a covalent glycosyl±enzyme intermediate provideinsights into the substrate recogn ition and active-site machinery of an S-glycosidase....
- 10
- 775
- 0
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx
... TGCTTCATCTTGCTGACGTGTACGTGGGACTC27 1A ATGTGTACGTGGGACTGGCACTTCGAAAGCC29 5A AAAATGGCCTACAGTTTAGCTCGGTACCW31 5A CAGAATCGCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATATC32 6A GTCAAGGAAGAAGCATCTGAGAGCCTAGTCTAGATAT234 ... AAATGAGCCCAACAAAGCCGAGAAAAACATTI9 7A- R9 8A AATTTGATGCTCGACAGGCTGCCGCGGAGACATGGW10 1A CAATCCGGGAGACAGCTGGTGATGAAAAF11 6A- L11 7A- L11 8A- G11 9A TAGCCACACTTGCAGCCGCGGCCAAAAATGW16 2A TTAATGGGGATGAGAGCGGTTGCCACTTTCTC16 7A ... TTAATGGGGATGAGAGCGGTTGCCACTTTCTC16 7A AGATGGGTTGGCAACTTTCGCTTCAAAAD17 7A- D17 9A- F18 1A TGAAAACCGCCAGTGCTATTGCTGTGAACAP23 3A- P23 4A CCTGACAGCAACTACGCAGCGTTCTGTTCAGC23 6A AGCAACTATCCACCGTTCGCTTCAGGGACTGE26 4A TGCTTCATCTTGCTGACGTGTACGTGGGACTC271A...
- 7
- 404
- 0
Báo cáo Y học: Functional epitope of common c chain for interleukin-4 binding ppt
... residues arepart of the ccbinding interface, but do not play a key role in binding. The loss of binding affinity of the four variantsI10 0A, L10 2A, Y1 0 3A a nd L20 8A i s not likely to be c aused by ... Ishii,N.,Asao,H.,Kimura ,Y. ,Takeshita,T.,Nakamura,M.,Tsuchiya, S., Konno, T., Maeda, M., Uchiyama, T. & Sugamura,K. (1994) Impairment of ligand binding and growth s ignaling of mutant IL-2 ... cysteine variants C16 0A and C20 9A exhibited a largely r educed binding affinity ( Kd> 500 lM).Thismaybecausedbystructuralperturbationoftheprotein. A direct role in binding, however, cannot...
- 10
- 447
- 0
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx
... allophycocyanins and phycocyanins,HPLC separation allowed a quantitative estimation of therelative amount of each protein component from the areaunderlying each peak. This was facilitated by the fact ... were phycocyanin and allophycocyanin,although at different stoichiometric ratios. In particular,band 2 contained the highest amount of both, with a significant reduction7 of the b-phycocyanin component. ... photodestruction of both a- andb-phycocyanins, but not of allophycocyaninswhich also contain bilins [28]. Because it is difficult toattribute the specific damage to variations in aromaticamino-acid content,...
- 9
- 477
- 0
Báo cáo Y học: Growth inhibition of mammalian cells by eosinophil cationic protein pptx
... four amino-acid residues (in bold letters) asalso indicated by the arrow at the bottom.RNase activity against yeast RNA (B) andbactericidal activity against S. aureus (C) of each ECP (d)and(À4) ... such as interleukin-4, arecapable in some cases of mediating regression of tumors[53,54]. In ammatory in ltrates comprised of eosinophilsmay also play an important role at the primary site of ... 309Growth inhibition of mammalian cells by eosinophil cationic proteinTakashi Maeda1, Midori Kitazoe1, Hiroko Tada1, Rafael de Llorens2, David S. Salomon3,Masakazu Ueda4, Hidenori Yamada1and...
- 10
- 423
- 0
Báo cáo Y học: Functional analysis of the rat bile salt export pump gene promoter Regulation by bile acids, drugs and endogenous compounds potx
... plas-mid extending to nucleotide )126 served as a template. Anantisense (5¢-CACTGTTTGCTTATATTTCAATGGAATAAAGTCCAGCTCTAGC-3¢; exchanged bases in bold)and sense (5¢-GCTAGAGCTGGACTTTATTCCATTGAAATA-TAAGCAAACAGTG-3¢) ... rifampin inhibit Bseppromoter activity they are capable of causing cholestasis by the reduction of canalicular bile acid transport capacity. In contrast with b-estradiol the anti-estrogen tamoxifen ... gene transcription. In analogy to the human choline acetyltransferase and thelipoprotein lipase gene the inhibition of the Bsep promoteractivity by estrogens may also be mediated by AP1 or AP1-like...
- 9
- 556
- 0
Báo cáo Y học: Functional integration of mitochondrial and hydrogenosomal ADP/ATP carriers in the Escherichia coli membrane reveals different biochemical characteristics for plants, mammals and anaerobic chytrids pdf
... (NdeIorBglII).aac Oligonucleotide sequenceaac1 (A. t.) Sense 5¢-TGCAGAGTTCcAtATGGTTGATCAAG-3¢Antisense 5¢-CGAAAAAAGGAGGAAGAAGCAATGC-3¢aac2 (A. t.) Sense 5¢-TGTAGAGGTTcAtATGGTTGAACAGACTC-3¢Antisense ... 5¢-TGTAGAGGTTcAtATGGTTGAACAGACTC-3¢Antisense 5¢-CTTAATGACTGCGGGATTTGGTGGTAC-3¢aac3 (A. t.) Sense 5¢-CTGATTTGTACAAcAtATGGATGGATC-3¢Antisense 5¢-GGGCTATTCTTTCATCATCCTCATCG-3¢aac1 (S.t.) Sense 5¢-TTAAACGTTcatATGGCAGATATGAACC-3¢Antisense ... database): AY042814 (aac1, A. thaliana),AY050857 (aac2, A. thaliana), AL021749/gene ¼ÔF20O9.60Õ (aac3, A. thaliana), X62123 (aac1, S. tubero-sum), D12770 (aac1, R. norwegicus), D12771 (aac2,R....
- 10
- 486
- 0
Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ