Báo cáo y học: "Intra-articular injection of recombinant TRAIL induces synovial apoptosis and reduces inflammation in a rabbit knee model of arthri" pdf

Báo cáo y học: "Intra-articular injection of recombinant TRAIL induces synovial apoptosis and reduces inflammation in a rabbit knee model of arthri" pdf

Báo cáo y học: "Intra-articular injection of recombinant TRAIL induces synovial apoptosis and reduces inflammation in a rabbit knee model of arthri" pdf

... stimulated synovial apoptosis and reduced inflammation. To examine whether intra-articular injection of recombinant chimeric human TRAIL protein (rTRAIL) also induces apoptosis of proliferating rabbit ... previously that local, intra-articular injection of an adenoviral vector expressing human tumor necrosis factor- related apoptosis- inducing ligand (TRAIL) in...

Ngày tải lên: 09/08/2014, 07:20

8 418 0
Báo cáo y học: "Human, viral or mutant human IL-10 expressed after local adenovirus-mediated gene transfer are equally effective in ameliorating disease pathology in a rabbit knee model of antigen-induced arthritis" ppt

Báo cáo y học: "Human, viral or mutant human IL-10 expressed after local adenovirus-mediated gene transfer are equally effective in ameliorating disease pathology in a rabbit knee model of antigen-induced arthritis" ppt

... vec- tors and analysis in the rabbit model of AIA and AK wrote the initial draft of the manuscript. JN and ZM assisted in the thera- peutic analysis in the rabbit model. PDR conceived of the study and ... days 3 and 7, the knees were lavaged, and on day 7 the animals sacrificed and their knee joints collected. (a) As a measure of proteoglycan breakdown,...

Ngày tải lên: 09/08/2014, 08:22

7 316 0
Báo cáo y học: "Hypoxic conditions increase hypoxia-inducible transcription factor 2α and enhance chondrogenesis in stem cells from the infrapatellar fat pad of osteoarthritis patients" pps

Báo cáo y học: "Hypoxic conditions increase hypoxia-inducible transcription factor 2α and enhance chondrogenesis in stem cells from the infrapatellar fat pad of osteoarthritis patients" pps

... 5'- CGGTTTGCCAGGAGCTATAGG-3' (forward) and 5'- TCTCGGCCATTTTTCCCATA-3' (reverse); COL1 0A1 , 5'- TACCTTGTGCCTCCCATTCAA-3' (forward) and 5'-TACAG- TACAGTGCATAAATAAATAATATATCTCCA-3' ... 5'-GAATGTGATGGGACTGCTTATG- TAGA-3' (forward) and 5'-GCATTTATTTGTACAGGCCCTA- CAA-3' (reverse); SOX6, 5'- CACCAGATATCGACAGAGTGGTCTT-3' (f...

Ngày tải lên: 09/08/2014, 10:20

9 307 0
Báo cáo sinh học: "High ERCC1 expression predicts cisplatin-based chemotherapy resistance and poor outcome in unresectable squamous cell carcinoma of head and neck in a betel-chewing area" pdf

Báo cáo sinh học: "High ERCC1 expression predicts cisplatin-based chemotherapy resistance and poor outcome in unresectable squamous cell carcinoma of head and neck in a betel-chewing area" pdf

... ERCC1 and XRCC1 and radioresistance in laryngeal tumors [33]. Cetuximab is an IgG1 monoclonal antibody against the ligand-binding domain of EGFR. Cetuximab binds Table 3 Univariate analyses of prognostic ... Chemotherapy added to locoregional treatment for head and neck squamous-cell carcinoma: three meta-analyses of updated individual data. MACH-NC Collaborative Group. Meta-Ana...

Ngày tải lên: 18/06/2014, 19:20

8 690 0
báo cáo hóa học:" High ERCC1 expression predicts cisplatin-based chemotherapy resistance and poor outcome in unresectable squamous cell carcinoma of head and neck in a betel-chewing area" pdf

báo cáo hóa học:" High ERCC1 expression predicts cisplatin-based chemotherapy resistance and poor outcome in unresectable squamous cell carcinoma of head and neck in a betel-chewing area" pdf

... the clinical data of patients and performed statistical data analysis. YJC coordinated the study and were involved in drafting the manuscript and revised it critically. All authors read and approved ... ERCC1 and XRCC1 and radioresistance in laryngeal tumors [33]. Cetuximab is an IgG1 monoclonal antibody against the ligand-binding domain of EGFR. Cetuximab binds Table 3 Un...

Ngày tải lên: 20/06/2014, 03:20

8 429 0
báo cáo hóa học:" Low RBM3 protein expression correlates with tumour progression and poor prognosis in malignant melanoma: An analysis of 215 cases from the Malmö Diet and Cancer Study" potx

báo cáo hóa học:" Low RBM3 protein expression correlates with tumour progression and poor prognosis in malignant melanoma: An analysis of 215 cases from the Malmö Diet and Cancer Study" potx

... coded as a separate category for categorical variables and as the mean of all observations for conti n- uous variables. Missing values for categorical variables co-varied and the multivariate model ... favourable histopathological parameters in primary melanomas and an independent predictor of a prolonged overall survival. In a transla- tional context, these findings are...

Ngày tải lên: 20/06/2014, 04:20

9 388 0
Báo cáo y học: "Pyridoxine supplementation corrects vitamin B6 deficiency but does not improve inflammation in patients with rheumatoid arthritis" pps

Báo cáo y học: "Pyridoxine supplementation corrects vitamin B6 deficiency but does not improve inflammation in patients with rheumatoid arthritis" pps

... vitamin B6 indices and the clinical and biochemical inflammatory markers [5], it is likely that inflammation causes vitamin B6 deficiency, yet it is also possi- ble that impaired vitamin B6 status ... indicating that randomi- zation was appropriate (Table 1). Indicators of vitamin B6 status before and after treatment are shown in Table 2. All markers of vitamin B6 status improve...

Ngày tải lên: 09/08/2014, 07:20

8 416 0
Báo cáo y học: "Are bone erosions detected by magnetic resonance imaging and ultrasonography true erosions? A comparison with computed tomography in rheumatoid arthritis metacarpophalangeal joints" pptx

Báo cáo y học: "Are bone erosions detected by magnetic resonance imaging and ultrasonography true erosions? A comparison with computed tomography in rheumatoid arthritis metacarpophalangeal joints" pptx

... modalities were evaluated with investigators blinded to clinical and other imaging data. Each MCP joint quadrant (radial and ulnar part of the metacarpal head and phalangeal base, respectively) ... coronal and (f) axial planes reveal the same erosions in the 3rd and 5th metacarpal heads as marked on the CT images. US at the ulnar aspect of the 5th metacarpal head, in (g) lo...

Ngày tải lên: 09/08/2014, 08:22

9 376 0
Báo cáo y học: "Human meniscus cells express hypoxia inducible factor-1α and increased SOX9 in response to low oxygen tension in cell aggregate culture" ppsx

Báo cáo y học: "Human meniscus cells express hypoxia inducible factor-1α and increased SOX9 in response to low oxygen tension in cell aggregate culture" ppsx

... GCAGGGTGGTAATATTGGCATT Reverse 5'-3' AAATCAATTCCCTCATCACTGAAAG, P4Hα(II) Forward 5'-3'TTAGCTGTCTAGCGCCTAGCAA Reverse 5'-3' TTTGGTTCACTGAAACA-TCTCACA P4Hα(III) Forward 5'-3' ... 5'-3'CTTTGGTTTGTGTTCGTGTTTTG Reverse 5'-3'AGAGAAAGAAAAAGGGAAAGGTAAGTTT COL 1A2 , collagen type I alpha 2; COL 2A1 , collagen type II alpha 1; HIF, hypoxia ind...

Ngày tải lên: 09/08/2014, 10:20

9 356 0
Báo cáo y học: "Advanced glycation end products induce cell cycle arrest and proinflammatory changes in osteoarthritic fibroblast-like synovial cells" doc

Báo cáo y học: "Advanced glycation end products induce cell cycle arrest and proinflammatory changes in osteoarthritic fibroblast-like synovial cells" doc

... tissue into the synovium may play a role in the initiation and perpetuation of inflammation and degradation processes. RAGE as well as AGEs are present in the synovial lining, sublining and endothelium ... mechanisms. Our data clearly demonstrate that AGEs increase the inflam- matory potential of FLS by activating RAGE and NFκB, which leads to increased expression of p...

Ngày tải lên: 09/08/2014, 14:22

19 395 0
w