Báo cáo y học: "B lymphocyte stimulator (BLyS) isoforms in systemic lupus erythematosus: disease activity correlates better with blood leukocyte BLyS mRNA levels than with plasma BLyS protein levels" ppsx

... TGCTTCATCTTG CTGACGTGTACGTGGGACT C27 1A ATGTGTACGTGGGACTGGCACTTCGAAAGC C29 5A AAAATGGCCTACAGTTTA GCTCGGTACC W31 5A CAGAATC GCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATAT C32 6A GTCAAGGAAGAAGCATCTGAGA GCCTAGTCTAGATAT 234 ... AAATGAGCCCAACAAAG CCGAGAAAAACATT I9 7A- R9 8A AATTTGATGCTCGACAGGCT GCCGCGGAGACATGG W10 1A CAATCCGGGAGACA GCTGGTGATGAAAA F11 6A- L11 7A- L11 8A- G11 9A TAGCCACACTT...

Ngày tải lên: 08/03/2014, 16:20

... V H gene < /b> repertoire < /b> of < /b> splenic < /b> B cells and somatic hypermutation in systemic lupus erythematosus Nicola L W Fraser 1 , Gary Rowley 1 , Max Field 2 and David I Stott 1 1 Division of < /b> Immunology, Infection ... 1, and has two distinct areas of < /b> staining for FDC and one large area of < /b> B cells encompassing both FDC regions. V...

Ngày tải lên: 09/08/2014, 01:21

... signaling via CD20 Commentary B cells as a therapeutic target in autoimmune disease Jörg J Goronzy and Cornelia M Weyand Departments of Medicine and Immunology, Mayo Clinic, Rochester, MN, USA Corresponding ... diseases. Preliminary clinical studies suggest therapeutic benefits in patients with classic autoantibody-mediated syndromes, such as autoimmune cytopenias. Treat...

Ngày tải lên: 09/08/2014, 01:21

... autoimmunity offers an exceptional opportunity to examine the effector Commentary From antibody insult to fibrosis in neonatal lupus – the heart of the matter Jill P Buyon and Robert M Clancy Department ... sections from several cases of CHB/myocarditis with varying degrees of pathology parallel the results obtained exploiting in vitro coculturing sys...

Ngày tải lên: 09/08/2014, 01:22

... rheumatoid factor; SE = HLA DRB1 shared epitope. Available online http:/ /arthritis- research.com/4/4/R1 Research article B lymphocytopenia in rheumatoid arthritis is associated with the DRB1 shared ... lymphocytes is plotted on the x axis, and the number of patients in each frequency range is plotted on the y axis. The overlays represent the Ga...

Ngày tải lên: 09/08/2014, 03:24

... functionally distinct with regards to production of cytokines and extracellular matrix [16,17] and it was recently demonstrated that only Thy-1 +ve fibroblasts are capable of differentiating into myofibroblasts after ... of myofibroblasts in dcSSc skinDetection of myofibroblasts in dcSSc skin. Cryosections from (a) nor- mal and (b-f) dcSSc skin were stained with an antib...

Ngày tải lên: 09/08/2014, 07:20

... disease activity and full-length BLyS or BLyS mRNA levels than that between disease activity and total BLyS (including BLyS) protein levels suggest that full-length BLyS and/or BLyS mRNA levels ... circulating levels of BLyS protein. Accordingly, we assessed peripheral blood leukocyte levels of BLyS mRNA isoforms (full-length BLyS and BLyS) an...

Ngày tải lên: 09/08/2014, 07:20

... therapeutic strategies of chronic renal injury: renoprotective effects of aldosterone blockade. J Pharmacol Sci 2006, 100:9-16. 23. Teplitsky V, Shoenfeld Y, Tanay A: The renin-angiotensin system in lupus: physiology, ... [10-12]). Aldosterone also exerts proinflammatory effects in the kidney and other tissues [13,14], such as leuko- cyte infiltration and increased expression...

Ngày tải lên: 09/08/2014, 10:22

... this article as: James et al.: Heel raises versus prefabricated orthoses in the treatment of posterior heel pain associated with calcaneal apophysitis (Sever’s Disease): study protocol for a randomised controlled ... prefabricated orthoses in the treatment of posterior heel pain associated with calcaneal apophysitis...

Ngày tải lên: 10/08/2014, 21:24

... expiratory muscle fati- guing protocol, than following an equivalent exercise duration when not first fatigued [36]. Interestingly, in that study subjects exercising with prior expiratory mus- cle fatigue ... muscle fatigue to develop in healthy individuals [18,19]. In COPD, the abdominal muscles are frequently recruited even during resting breathing [20]. When walking to ex...

Ngày tải lên: 12/08/2014, 11:20

... of 14 RESEARC H ARTIC L E Open Access B-lymphocyte stimulator/a proliferation-inducing ligand heterotrimers are elevated in the sera of patients with autoimmune disease and are neutralized by ... shown). The inhibition of BLyS, APRIL, and the heterotrimers by atacicept is consistent with the observed effects of atacicept and/ or mu...

Ngày tải lên: 12/08/2014, 12:20

... receptor signaling architecture in normal and systemic lupus erythematosus T cells. SLE, systemic lupus erythematosus; TCR, T cell receptor. Normal T cell SLE T cell α α SLE T cell α Aggregated ... Ding XZ, Dennis GJ, Tsokos GC: Altered pattern of TCR/CD3- mediated protein-tyrosyl phosphorylation in T cells from patients with systemic lupus erythematos...

Ngày tải lên: 12/08/2014, 15:22

... multicentre observational study examining the relationship between the amount of energy and protein administered during ICU stay and clinical outcomes in critically ill patients, and the extent to which ... Enquiry into Patient Outcome and Death) interest recently and data into provision of care and outcomes have been published [13]. French investigators Floccard and colle...

Ngày tải lên: 13/08/2014, 19:20

... strategy (NPPV combined with FBO in COPD with hypercapnic encephalopathy) in the most challenging patients. Abbreviations COPD, chronic obstructive pulmonary disease; FBO,  breoptic bronchoscopy; ... Naldi M, Maccari U: Early  beroptic bronchoscopy during non- invasive ventilation in patients with decompensated chronic obstructive pulmonary disease due to community-...

Ngày tải lên: 13/08/2014, 20:22

... the CD4+ lymphocyte ATP content, and arguably, the immune sta- tus of an individual patient. We have also demonstrated that a lower CD4+ lymphocyte ATP content is associated with a higher mortality, ... be associated with mortality in several patient populations [9]. Interestingly, data are beginning to accumulate sup- porting the notion that viruses may reactivate in immu- no...

Ngày tải lên: 13/08/2014, 20:22