Báo cáo y học: "Effect of a small molecule inhibitor of nuclear factor-κB nuclear translocation in a murine model of arthritis and cultured human synovial cells" pps

Báo cáo Y học: Effect of ibuprofen and warfarin on the allosteric properties of haem– human serum albumin A spectroscopic study potx

Báo cáo Y học: Effect of ibuprofen and warfarin on the allosteric properties of haem– human serum albumin A spectroscopic study potx

... most of the antioxidant capacity of human serum, either directly or by binding and carrying radical scavengers, or by sequestering transition metal ions with pro-oxidant activity. Finally, HSA acts ... shift of allosteric equilibrium (a) of HSA. Keywords: allostery; haem human serum albumin; human serum albumin; ibuprofen; warfarin. Human serum albumin (HSA), the most promine...

Ngày tải lên: 31/03/2014, 23:20

7 550 0
Báo cáo y học: "Effect of allergen-specific immunotherapy with purified Alt a1 on AMP responsiveness, exhaled nitric oxide and exhaled breath condensate pH: a randomized double blind study" ppsx

Báo cáo y học: "Effect of allergen-specific immunotherapy with purified Alt a1 on AMP responsiveness, exhaled nitric oxide and exhaled breath condensate pH: a randomized double blind study" ppsx

... glycerinated saline. Data analysis An intention-to-treat approach was followed in the ana- lysis of efficacy data. All patients with a baseline and at least one postrandomization measurement were included in the ... were repeated. The dose of intranasal or ICS (if used) was maintained unchanged during the study. Salbutamol metered-dose inhaler, oral antihistamines and intranasal...

Ngày tải lên: 08/08/2014, 21:20

11 546 0
Báo cáo y học: " Effect of Weight Reduction on Cardiovascular Risk Factors and CD34-positive Cells in Circulatio"

Báo cáo y học: " Effect of Weight Reduction on Cardiovascular Risk Factors and CD34-positive Cells in Circulatio"

... reagent to check the non-specific binding of the CD34-PE monoclonal antibody. Statistical analysis All data were analyzed by Systat software (Sys- tat Inc) and KaleidaGraph software. Variables ... weekly for all participants: fat free mass, body fat, BMI, extracellular/intracellular water, total body water and basal metabolic rate. For part of participants blood chemistry parame...

Ngày tải lên: 25/10/2012, 10:51

8 594 0
Báo cáo y học: "Effect of Acute Administration of an Herbal Preparation on Blood Pressure and Heart Rate in Humans"

Báo cáo y học: "Effect of Acute Administration of an Herbal Preparation on Blood Pressure and Heart Rate in Humans"

... product containing bitter orange extract, caffeine and green tea extract does not lead to increased cardiovascular stress and that fat oxidation may increase in certain populations. Key words: ... 17. Thomas JE, Munir JA, McIntyre PZ, et al. STEMI in a 24-year-old man after use of a synephrine-containing dietary supplement. A case report and review of the literature....

Ngày tải lên: 25/10/2012, 11:10

6 491 0
Báo cáo y học: " Effect of dose-escalation of 5-fluorouracil on circadian variability of it"

Báo cáo y học: " Effect of dose-escalation of 5-fluorouracil on circadian variability of it"

... 19. Hayashi K, Ando N, Watanabe H, et al. Phase II evaluation of protracted infusion of cisplatin and 5-fluorouracil in advanced squamous cell carcinoma of the esophagus: a Japan Esophageal Oncology ... Sakaeda T, Yamamori M, Kuwahara A, et al. Pharmacokinetics and pharmacogenomics in esophageal cancer chemoradio- therapy. Adv Drug Deliv Rev 2009; 61: 388-401. 11. Miki I...

Ngày tải lên: 26/10/2012, 09:39

7 374 0
Báo cáo y học: "Effect of 1,25-dihydroxy-vitamin D3 in experimental sepss"

Báo cáo y học: "Effect of 1,25-dihydroxy-vitamin D3 in experimental sepss"

... T- and B-lymphocyte dif- ferentiation and activity [11,12,13]. The inflammatory cytokines, TNF-alpha and cer- tain interleukins play a key-role in initiating systemic inflammatory response syndrome ... in three different models of experimental sepsis and DIC in rats, using a controlled and clinically relevant administration of vitamin D. 2. Material and methods...

Ngày tải lên: 26/10/2012, 09:57

6 506 1
Báo cáo y học: "Effect of corticosteroids on phlebitis induced by intravenous infusion of antineoplastic agents in rabbits"

Báo cáo y học: "Effect of corticosteroids on phlebitis induced by intravenous infusion of antineoplastic agents in rabbits"

... was inflammatory cell infiltration (Grades 1-3) in the proximal part of the vein in all 8 animals and in the distal part of the vein in 7 of the 8 animals. Edema (Grades 1-3) was found in ... proximal part of the vein in 6 of the 8 animals and in the distal part of the vein in 7 of the 8 animals. Epidermal degeneration (Grades 1-3) was found in both...

Ngày tải lên: 26/10/2012, 09:57

6 711 0
Báo cáo y học: "Effect of antibodies on the expression of Plasmodium falciparum circumsporozoite protein gene"

Báo cáo y học: "Effect of antibodies on the expression of Plasmodium falciparum circumsporozoite protein gene"

... hours. Quantification of cDNA was determined against a standard curve and normalised by the amount of ldh expression. Percentage of increase/decrease expression was calculated by dividing treated ... of malaria parasites. Exp Parasitol 1989; 69: 351-356. 13. Levitt A, Dimayuga FO, Ruvolo VR. Analysis of malarial transcripts using cDNA-directed polymerase chain reaction. J...

Ngày tải lên: 02/11/2012, 10:14

4 524 0
Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot

Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot

... substrate. These oligomeric substrates were prepared by hybridizing 1 lm of the 5¢-FAM-labeled 29 base DNA 13 -RNA 4 -DNA 12 (5¢-AATA GAGAAAAAGaaaaAAGATGGCAAAG-3¢) and DNA 15 - RNA 1 -DNA 13 (5¢-AATAGAGAAAAAGAAaAAAGATG GCAAAG-3¢) ... 5¢-GGGG AAGCTTCTA GTGGTGGTGGTGGTGGTGCTTACGTTTAAAAAAT CCATC-3¢ for RNH2B-R; 5¢-ATAT AAGCTTCTCTCAA GGAGATATACTTATGACCAAAGATGCCGTG-3¢ for RNH2C-F; and 5¢-GGAG...

Ngày tải lên: 17/03/2014, 17:20

14 483 0
Báo cáo Y học: Effect of adenosine 5¢-[b,c-imido]triphosphate on myosin head domain movements Saturation transfer EPR measurements without low-power phase setting ppt

Báo cáo Y học: Effect of adenosine 5¢-[b,c-imido]triphosphate on myosin head domain movements Saturation transfer EPR measurements without low-power phase setting ppt

... Mulhern, S .A. & Eisenberg, E. (1978) Interaction of spin-labeled and N-(iodoacetylaminoethyl)-5-naphthylamine-1-sulfonic acid SH1-blocked heavy meromyosin and myosin with actin and ade- nosine triphosphate. ... AM–ADP state. In experiments involving MgADP, the activity of adenylate kinase was inhibited by the addition of 50 l M diadenosine pentaphosphate. The other analogue...

Ngày tải lên: 24/03/2014, 03:21

10 563 0
w