Báo cáo y học: "Catabolic stress induces expression of hypoxia-inducible factor (HIF)-1α in articular chondrocytes: involvement of HIF-1α in the pathogenesis of osteoarthritis" ppt

... Lee JY, et al. Vacuolating cytotoxin in Helico- bacter pylori water-soluble proteins upregulates chemokine expression in human eosinophils via Ca 2+ influx, mitochondrial reactive oxygen intermediates, ... i n v i t r o and in vivo. Moreo- ver, Hp induces genomic instability in nuclear CA repeats in mice and in mtDNA of AGS cells and chronic gastritis tissue,...

Ngày tải lên: 25/10/2012, 11:18

... a long form of Rab32 (see Discussion). Bacterial expression of Rab31 and Rab32 GSTRab31, GSTRab32 and the potentially GTPase- deđcient mutants of t hese proteins, GST Rab31 Q64L and GST±R ab32 Q85L , ... only Rab31 and not GST, GST Rab32 or GST±Rab5A (Fig. 7C). Similarly, antibody to Rab32 detected only Rab32 (and minor proteolytic fragments) (Fig. 7D). [ 35 S...

Ngày tải lên: 08/03/2014, 16:20

... disulfide bal- ance of these organs, and whether cysteine efflux to the blood was paralleled by a change in the Cys concentration in other tissues. Diamide, at 60 min from the start of administration, ... increase in the concentration of total cysteine showed an almost linear dose dependence, as shown in Fig. 6, in which the maximum total cysteine accumu...

Ngày tải lên: 16/03/2014, 02:20

... CTGF/Hcs24 induces chondrocyte differentiation through a p38 mitogen-activated protein kinase (p38MAPK), and proliferation through a p44/42 MAPK/extracellular-signal regulated kinase (ERK) Gen Yosimichi 1,2 , ... Yosimichi 1,2 , Tohru Nakanishi 1 , Takashi Nishida 1,3 , Takako Hattori 1 , Teruko Takano-Yamamoto 2 and Masaharu Takigawa 1,3 1 Depart...

Ngày tải lên: 24/03/2014, 04:21

... of IL-6 and IL-8 in rheumatoid arthritis synovial fibroblasts via NF- κ B- and PI3-kinase/Akt-dependent pathways Sue-Yun Hwang 1 , Ju-Young Kim 1 , Kyoung-Woon Kim 1 , Mi-Kyung Park 1 , Youngmee ... signaling in human monocyte cell line [10] and embryonic fibroblasts [11], respectively, and yet cytoplasmic players transmitting IL-17-mediated activation in R...

Ngày tải lên: 09/08/2014, 01:23

... Bradley LA, Alarcon GS, Triana-Alexander M, Alexander RW, Martin MY, Alberts KR: Perceived physical and emotional trauma as precipitating events in fibromyalgia. Associations with health care ... (ACTH) from the anterior Review Psychological stress and fibromyalgia: a review of the evidence suggesting a neuroendocrine link Anindya Gupta and Alan J Silman ARC Epid...

Ngày tải lên: 09/08/2014, 01:23

... radicals) may induce the expression of HIF-1α in articular chondrocytes. IL-1 has been shown both to inhibit chondrocyte anabolic activity, including the down-regulation of proteoglycan synthesis, ... support the idea that Figure 3 Catabolic factors induce the expression of HIF-1α protein in human articular cartilageCatabolic factors induce the expression of...

Ngày tải lên: 09/08/2014, 06:23

Ngày tải lên: 09/08/2014, 07:20

... activation and aggrecan and collagen release. Materials and methods Cartilage degradation assay Bovine nasal cartilage was cultured as previously described [20]. Briefly, bovine nasal septum cartilage ... ATATTTATACGCCTTTTGATTCCT 297 GGTACCCGTAGAGCTTCCGTTCC α 2 M GCCCGCTTTGCCCCTAACA 359 TCGTCCACCCCACCCTTGATG RECK GTAATTGCCAAAAAGTGAAA 352 TAGGTGCATATAAACAAGAAGTA ADAMTS-1 GCTGCC...

Ngày tải lên: 09/08/2014, 08:22

... article Catabolic cytokine expression in degenerate and herniated human intervertebral discs: IL-1β and TNFα expression profile Christine Lyn Le Maitre, Judith Alison Hoyland and Anthony J Freemont Tissue ... the first interleukin-1 inhibitor in the treatment of rheumatoid arthritis. Int J Clin Pract 2003, 57:231-234. 33. Le Maitre CL, Fre...

Ngày tải lên: 09/08/2014, 10:20

... 4 Inhibition of IL-23-induced osteoclastogenesis by osteoprotegerin, anti -IL-17 antibody, and etanerceptInhibition of IL-23-induced osteoclastogenesis by osteoprotegerin, anti -IL-17 antibody, and ... showed that IL-23 induced key cytokines such as IL-17 and IFN-γ and that IL-23 induced human osteoclastogenesis via these cytokines (Figure 9). Our findings indicate tha...

Ngày tải lên: 09/08/2014, 10:21

... albicans infection of prostaglandin E2 (PGE 2 ) production by synovial fibroblastsThe effect of Candida albicans infection of prostaglandin E2 (PGE 2 ) production by synovial fibroblasts. Synovial ... evaluated by an electrophoretic mobility shift assay. Results Infection of synovial fibroblasts with C. albicans resulted in cyclo-oxygenase 2 expressio...

Ngày tải lên: 09/08/2014, 14:20

... previously identified in HIV-1 transgene expression impaired alveolar epithelial barrier function in vivo and increased permeability of alveolar epithelial monolayers in vitroFigure 3 HIV-1 transgene ... HIV-1 transgene expression in rats on alveolar epithelial barrier function. Alveolar epithelial barrier function was assessed by determining...

Ngày tải lên: 10/08/2014, 05:21

... responsibility for the integrity of the data and the accuracy of the data analysis. Bang and Bae participated in the study design, acquisition of data, analysis and interpretation of data, statis- tical aspects, ... Burmester GR, Salama A, Dorner T: Detailed analysis of the variability of peptidylarginine deiminase type 4 in German patients with rheumatoid arthritis...

Ngày tải lên: 12/08/2014, 14:22

... purposes) Respiratory Research Open Access Research Cryptococcus neoformans induces IL-8 secretion and CXCL1 expression by human bronchial epithelial cells Loïc Guillot 1 , Scott F Carroll 1,2 , Mohamed Badawy 4 ... genes by C. neoformans in human BEAS-2B cells using an oligonucleotide microarray and confirmed the hybridization data by conventional and rea...

Ngày tải lên: 12/08/2014, 15:21