Báo cáo y học: "Soluble RAGE: a hot new biomarker for the hot joint" pdf

... membrane. J Rheumatol 1999, 26:2523-2528. 10. Yan SF, Ramasamy R, Naka Y, Schmidt AM: Glycation, inflam- mation and RAGE: a scaffold for the macrovascular complica- tions of diabetes and beyond. ... such as the following: Do plasma sRAGE levels vary from day to day in a subject? Do they vary over the lifespan of the individual? What were the levels of sRAGE in the RA subj...

Ngày tải lên: 09/08/2014, 06:23

... designed and validated several years ago. The new apparatus allows easier recording of animals by means of a battery of radar devices housed in specific ele- ments and arranged in a smaller space ... time series. The data files are automatically saved to the hard disk, allowing immediate analyses of the data. Competing interests The author(s) declare that they have no competin...

Ngày tải lên: 10/08/2014, 09:20

... Masahiko Takahashi - masahiko@med.niigata-u.ac.jp; Masayasu Oie - moie@med.niigata-u.ac.jp; Yuetsu Tanaka - yuetsu@s4.dion.ne.jp; Yutaka Aoyagi - aoy@med.niigata-u.ac.jp; Masahiro Fujii* - fujiimas@med.niigata-u.ac.jp * ... Tax2 Toshiyuki Shoji †1,2 , Masaya Higuchi †1 , Rie Kondo 1 , Masahiko Takahashi 1 , Masayasu Oie 1 , Yuetsu Tanaka 3 , Yutaka Aoyagi 2 and Masahiro Fujii* 1 Address:...

Ngày tải lên: 12/08/2014, 23:22

... technical replicates and calculated the mean of these values. The ratio of this mean on the average of the intensity across the array set was then obtained. A ratio greater than 2 indicates that there ... that there was hybridization to a specific gene 2-fold above the background intensity across the whole array. Authors' contributions EG analyzed all the microarray d...

Ngày tải lên: 13/08/2014, 13:20

... cell lysates were stored at )70 °C until assayed with a RIA (radioimmunoassay) kit (Amersham, Little Chalfont). Data analysis was achieved with the sigmoidal dose–response curve fitting program ALLFIT . ... TBqÆmmol )1 . Binding and cAMP assay For the determination of the binding affinity and the biological potency of the photoactivatable CRF antagonists, HEK 293 cell lines, stabl...

Ngày tải lên: 31/03/2014, 08:20

... with MRSA. Standard therapy concerning antibiotic treatment has failed to eradicate t he MRSA, so that we decided for an alternative antimicrobial strategy in the form of Daptomy- cin application. ... Staphylococcus aureus (MRSA).However,thereare many reasons for clinical failure of Vancomycin [8,9], therefore the need for alternative th erapies that targe t MRSA has become apparent...

Ngày tải lên: 10/08/2014, 09:22

... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele- specific primer s Pnf (AGCATTTGGTTTTAAATTATG- GAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelofibrosis a...

Ngày tải lên: 10/08/2014, 21:23

... 'summarized' and refers to the presentation of information in a tabular, rather than descriptive form. Templates are created specif- ically for a particular setting and can be filled in by the reporting ... data collection and analysis. All authors read and approved the final manuscript. Additional material Acknowledgements This study has been funded by Cancer Services I...

Ngày tải lên: 11/08/2014, 05:21

... diagnostic evaluation of the patients; MG carried out the statistical analyses, coordinated the study and wrote the manuscript. All authors read and approved the final manuscript. Authors’ information To ... FI2009-00229 from the Generalitat de Catalunya. We thank Nalisoa Randriamahefa for her excellent technical assistance. We also thank DFG for support. Author details 1 Facu...

Ngày tải lên: 11/08/2014, 15:22

... to the Royal Children's Hospital, Melbourne, Victoria, Australia with acute diarrhea between 1978 and 1999. For a portion of these samples (70), RNA was extracted in the same manner as the ... study was approved by the Human Research Protection Office of Washington University. Raw sewage One 10 L-sample of raw sewage was collected in an urban wastewater treatment plant in th...

Ngày tải lên: 12/08/2014, 04:21