Báo cáo y học: "Systemic lupus erythematosus induced by anti-tumour necrosis factor alpha therapy: a French national survey" ppsx

Báo cáo y học: "Systemic lupus erythematosus induced by anti-tumour necrosis factor alpha therapy: a French national survey" ppsx

Báo cáo y học: "Systemic lupus erythematosus induced by anti-tumour necrosis factor alpha therapy: a French national survey" ppsx

... Access Available online http://arthritis-research.com/content/7/3/R545 R545 Vol 7 No 3 Research article Systemic lupus erythematosus induced by anti-tumour necrosis factor alpha therapy: a French ... alpha treatment and may be complicated by central Table 3 Signs of systemic lupus erythematosus (SLE) in 12 patients under anti-tumour necrosis factor alpha...

Ngày tải lên: 09/08/2014, 06:22

7 386 0
Báo cáo y học: " Systemic lupus erythematosus associated with type 4 renal tubular acidosis: a case report and review of the literatur" pps

Báo cáo y học: " Systemic lupus erythematosus associated with type 4 renal tubular acidosis: a case report and review of the literatur" pps

... journal. Abbreviations RTA: renal tubular acidosis; SLE: systemic lupus erythematosus; SLEDAI: systemic lupus erythematosus disease activity index; TTKG: transtubular potassium gradient. Acknowledgements We ... clinical and laboratory findings. Am J Kidney Dis 1985, 6:59-63. 4. Li SL, Liou LB, Fang FT, Tsai WP: Symptomatic renal tubular acidosis (RTA) in patients with systemic lupus...

Ngày tải lên: 11/08/2014, 00:23

5 509 0
Báo cáo y học: "Systemic lupus erythematosus and the type I interferon system" docx

Báo cáo y học: "Systemic lupus erythematosus and the type I interferon system" docx

... Dzionek A, Sohma Y, Nagafune J, Cella M, Colonna M, Facchetti F, Gunther G, Johnston I, Lanzavecchia A, Nagasaka T, Okada T, Vermi W, Winkels G, Yamamoto T, Zysk M, Yamaguchi Y, Scmitz J: BDCA-2, a ... Cella M, Jarrossay D, Facchetti F, Alebardi O, Nakajima H, Lanza- vecchia A, Colonna M: Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interfe...

Ngày tải lên: 09/08/2014, 01:21

8 420 0
Báo cáo y học: " Systemic lupus erythematosus: a BLySful, yet BAFFling, disorder" pps

Báo cáo y học: " Systemic lupus erythematosus: a BLySful, yet BAFFling, disorder" pps

... may have profound ramifications for antagonist therapy, since a clinically effi- cacious BLyS antagonist may need to be directed against not just BLyS but against APRIL as well. Are all SLE patients ... 104:115-122. 17. Kayagaki N, Yan M, Seshasayee D, Wang H, Lee W, French DM, Grewal IS, Cochran AG, Gordon NC, Yin J, Starovasnik MA, Dixit VM: BAFF/BLyS receptor 3 binds the B cell surviva...

Ngày tải lên: 09/08/2014, 01:21

3 349 0
Báo cáo y học: "Interactions between IL-32 and tumor necrosis factor alpha contribute to the exacerbation of immune-inflammatory diseases" ppt

Báo cáo y học: "Interactions between IL-32 and tumor necrosis factor alpha contribute to the exacerbation of immune-inflammatory diseases" ppt

... 5'-CATCTTCTCAAAATTCGAG-3' Antisense 5'-TGGGAGTAGACAAGGTACAACCC-3' Mouse IL-1β Sense 5'-CAACCAACAAGTGATATTCTCCATG-3' Antisense 5'-GATCCACACTCTCCAGCTGCA-3' Mouse ... 5'-GTCTCCTACCAGACCAAG-3' Antisense 5'-CAAAGTAGACCTGCCCAGACTC-3' Human β-actin Sense 5'-TTCCTGGGCATGGAGTCCT-3' Antisense 5'-AGGAGGAGCAATGATCTTGATC-3' Mo...

Ngày tải lên: 09/08/2014, 08:23

13 552 0
Báo cáo y học: "Therapeutic effects of antibodies to tumor necrosis factor-α, interleukin-6 and cytotoxic T-lymphocyte antigen 4 immunoglobulin in mice with glucose-6-phosphate isomerase induced arthritis" docx

Báo cáo y học: "Therapeutic effects of antibodies to tumor necrosis factor-α, interleukin-6 and cytotoxic T-lymphocyte antigen 4 immunoglobulin in mice with glucose-6-phosphate isomerase induced arthritis" docx

... 196:77-85. 18. Kawane K, Ohtani M, Miwa K, Kizawa T, Kanbara Y, Yoshioka Y, Yoshikawa H, Nagata S: Chronic polyarthritis caused by mam- malian DNA that escapes from degradation in macrophages. Nature 2006, ... collected on day 14. The titers of anti-GPI antibodies were analyzed by enzyme-linked immunosorbent assay. Each symbol represents a single animal. Data are expressed as mean...

Ngày tải lên: 09/08/2014, 10:23

8 318 0
Báo cáo y học: "Predicting the future of anti-tumor necrosis factor therapy" potx

Báo cáo y học: "Predicting the future of anti-tumor necrosis factor therapy" potx

... of therapy in a readily available biosample, such as peripheral blood (DNA, RNA, protein, phenotypic cell markers, and/or metabolites), although this compartment may not have direct implications for ... rheumatoid arthritis (RA). Essentially, two phases of unresponsiveness might be identified: a primary phase directly after the start of treatment and a secondary phase that develops in i...

Ngày tải lên: 09/08/2014, 14:21

2 293 0
Báo cáo y học: " Regulation of cardiac microRNAs by serum response factor" potx

Báo cáo y học: " Regulation of cardiac microRNAs by serum response factor" potx

... 5’-cacagccctgggatggagagtgggctgtgggt- cacct gaggctgtggttcag-3’ . Cardiac a- actin: 5’ -agggggctca- gag gattccaagaagcacaatacggtcatcctgaatataaggtaggctaa-3’; sarcoplasmic reticulum Ca 2+ -ATPase (SERCA2), 5’-tcagt catgcagagggctggtagatgtgttgctaacaacgcacatgcacgcaccc gaaca-3’. The ... 5’-ggtcatgcacacaca- taccac-3’. pri-mir499 forward: 5’-gcatgtgaacatcacagcaag-3’, pri-mir499 reverse: 5’-ccaaacaccacc...

Ngày tải lên: 10/08/2014, 05:21

13 389 0
Báo cáo y học: "Anorectal stenosis after treatment with tumor necrosis factor a antibodies: a case series." doc

Báo cáo y học: "Anorectal stenosis after treatment with tumor necrosis factor a antibodies: a case series." doc

... treatment with anti- tumor necrosis factor a (anti-TNF -a) agents. Case presentation: Two patients, a 24-year-old Irish Caucasian man and a 64-year-old Irish Caucasian woman, developed symptoms attributable ... clinical examination, she was found to have a ste- nosed anal canal. Her laboratory parameters had all nor- malized, as had her HBI to 1. She was admitted for endoscopic ev...

Ngày tải lên: 11/08/2014, 03:20

4 220 0
Báo cáo y học: "The spliceosomal autoantigen heterogeneous nuclear ribonucleoprotein A2 (hnRNP-A2) is a major T cell autoantigen in patients with systemic lupus erythematosus" potx

Báo cáo y học: "The spliceosomal autoantigen heterogeneous nuclear ribonucleoprotein A2 (hnRNP-A2) is a major T cell autoantigen in patients with systemic lupus erythematosus" potx

... CA, USA) and anion exchange chromatography on DEAE Sepha- rose (Pharmacia, Uppsala, Sweden) essentially as described [27]. Endotoxin content was determined by the lympholytic amoebocyte lysate ... protein as described [27]. Purification from bacterial lysates was achieved by Ni-NTA affinity chromatography (Quiagen, Hilden, Germany) followed by Polymyxin B Sepharose adsorption (BioRad, H...

Ngày tải lên: 09/08/2014, 08:22

10 396 0
w