Báo cáo y học: "Systemic lupus erythematosus induced by anti-tumour necrosis factor alpha therapy: a French national survey" ppsx
Báo cáo y học: "Systemic lupus erythematosus induced by anti-tumour necrosis factor alpha therapy: a French national survey" ppsx
... Access
Available online http://arthritis-research.com/content/7/3/R545
R545
Vol 7 No 3
Research article
Systemic lupus erythematosus induced by anti-tumour necrosis
factor alpha therapy: a French ... alpha treatment and may be complicated by central
Table 3
Signs of systemic lupus erythematosus (SLE) in 12 patients under anti-tumour necrosis factor alpha...
Báo cáo y học: " Systemic lupus erythematosus associated with type 4 renal tubular acidosis: a case report and review of the literatur" pps
... journal.
Abbreviations
RTA: renal tubular acidosis; SLE: systemic lupus erythematosus; SLEDAI:
systemic lupus erythematosus disease activity index; TTKG: transtubular
potassium gradient.
Acknowledgements
We ... clinical and laboratory findings. Am J Kidney
Dis 1985, 6:59-63.
4. Li SL, Liou LB, Fang FT, Tsai WP: Symptomatic renal tubular acidosis (RTA)
in patients with systemic lupus...
Báo cáo y học: "Systemic lupus erythematosus and the type I interferon system" docx
... Dzionek A, Sohma Y, Nagafune J, Cella M, Colonna M, Facchetti
F, Gunther G, Johnston I, Lanzavecchia A, Nagasaka T, Okada T,
Vermi W, Winkels G, Yamamoto T, Zysk M, Yamaguchi Y, Scmitz
J: BDCA-2, a ... Cella M, Jarrossay D, Facchetti F, Alebardi O, Nakajima H, Lanza-
vecchia A, Colonna M: Plasmacytoid monocytes migrate to
inflamed lymph nodes and produce large amounts of type I
interfe...
Báo cáo y học: " Systemic lupus erythematosus: a BLySful, yet BAFFling, disorder" pps
... may have profound
ramifications for antagonist therapy, since a clinically effi-
cacious BLyS antagonist may need to be directed against
not just BLyS but against APRIL as well.
Are all SLE patients ... 104:115-122.
17. Kayagaki N, Yan M, Seshasayee D, Wang H, Lee W, French DM,
Grewal IS, Cochran AG, Gordon NC, Yin J, Starovasnik MA, Dixit
VM: BAFF/BLyS receptor 3 binds the B cell surviva...
Báo cáo y học: "Interactions between IL-32 and tumor necrosis factor alpha contribute to the exacerbation of immune-inflammatory diseases" ppt
... 5'-CATCTTCTCAAAATTCGAG-3'
Antisense 5'-TGGGAGTAGACAAGGTACAACCC-3'
Mouse IL-1β Sense 5'-CAACCAACAAGTGATATTCTCCATG-3'
Antisense 5'-GATCCACACTCTCCAGCTGCA-3'
Mouse ... 5'-GTCTCCTACCAGACCAAG-3'
Antisense 5'-CAAAGTAGACCTGCCCAGACTC-3'
Human β-actin Sense 5'-TTCCTGGGCATGGAGTCCT-3'
Antisense 5'-AGGAGGAGCAATGATCTTGATC-3'
Mo...
Báo cáo y học: "Therapeutic effects of antibodies to tumor necrosis factor-α, interleukin-6 and cytotoxic T-lymphocyte antigen 4 immunoglobulin in mice with glucose-6-phosphate isomerase induced arthritis" docx
... 196:77-85.
18. Kawane K, Ohtani M, Miwa K, Kizawa T, Kanbara Y, Yoshioka Y,
Yoshikawa H, Nagata S: Chronic polyarthritis caused by mam-
malian DNA that escapes from degradation in macrophages.
Nature 2006, ...
collected on day 14. The titers of anti-GPI antibodies were analyzed by
enzyme-linked immunosorbent assay. Each symbol represents a single
animal. Data are expressed as mean...
Báo cáo y học: "Predicting the future of anti-tumor necrosis factor therapy" potx
... of therapy in
a readily available biosample, such as peripheral blood (DNA,
RNA, protein, phenotypic cell markers, and/or metabolites),
although this compartment may not have direct implications
for ... rheumatoid arthritis (RA). Essentially, two
phases of unresponsiveness might be identified: a primary
phase directly after the start of treatment and a secondary
phase that develops in i...
Báo cáo y học: " Regulation of cardiac microRNAs by serum response factor" potx
... 5’-cacagccctgggatggagagtgggctgtgggt-
cacct gaggctgtggttcag-3’ . Cardiac a- actin: 5’ -agggggctca-
gag gattccaagaagcacaatacggtcatcctgaatataaggtaggctaa-3’;
sarcoplasmic reticulum Ca
2+
-ATPase (SERCA2), 5’-tcagt
catgcagagggctggtagatgtgttgctaacaacgcacatgcacgcaccc
gaaca-3’.
The ... 5’-ggtcatgcacacaca-
taccac-3’. pri-mir499 forward: 5’-gcatgtgaacatcacagcaag-3’,
pri-mir499 reverse: 5’-ccaaacaccacc...
Báo cáo y học: "Anorectal stenosis after treatment with tumor necrosis factor a antibodies: a case series." doc
... treatment with anti-
tumor necrosis factor a (anti-TNF -a) agents.
Case presentation: Two patients, a 24-year-old Irish Caucasian man and a 64-year-old Irish Caucasian woman,
developed symptoms attributable ... clinical examination, she was found to have a ste-
nosed anal canal. Her laboratory parameters had all nor-
malized, as had her HBI to 1. She was admitted for
endoscopic ev...
Báo cáo y học: "The spliceosomal autoantigen heterogeneous nuclear ribonucleoprotein A2 (hnRNP-A2) is a major T cell autoantigen in patients with systemic lupus erythematosus" potx
... CA,
USA) and anion exchange chromatography on DEAE Sepha-
rose (Pharmacia, Uppsala, Sweden) essentially as described
[27]. Endotoxin content was determined by the lympholytic
amoebocyte lysate ... protein as described [27].
Purification from bacterial lysates was achieved by Ni-NTA
affinity chromatography (Quiagen, Hilden, Germany) followed
by Polymyxin B Sepharose adsorption (BioRad, H...