Báo cáo y học: "Quantitative ultrasound can assess the regeneration process of tissue-engineered cartilage using a complex between adherent bone marrow cells and a three-dimensional scaffold" docx

Báo cáo y học: "Quantitative ultrasound can assess the regeneration process of tissue-engineered cartilage using a complex between adherent bone marrow cells and a three-dimensional scaffold" docx

Báo cáo y học: "Quantitative ultrasound can assess the regeneration process of tissue-engineered cartilage using a complex between adherent bone marrow cells and a three-dimensional scaffold" docx

... in a uniform array at the palisades, similar to hyaline cartilage. Gross appearance of a cartilage defect in the patella groove implanted with a complex between adherent bone marrow cells and ... developed a new ultrasonic evaluation system for articular cartilage and showed that this system can quanti- tatively evaluate cartilage degeneration clinicall...

Ngày tải lên: 09/08/2014, 06:22

8 355 0
Báo cáo y học: "Neurophysiological study to assess the severity of each site through the motor neuron fiber in entrapment neuropathy" potx

Báo cáo y học: "Neurophysiological study to assess the severity of each site through the motor neuron fiber in entrapment neuropathy" potx

... described that thenar atrophy often proceeds hypesthesia in the median distribution for many months or many years and the onset of thener muscle atrophy was always gradual. Also if the paralysis had existed ... Sakai, Japan, 2 Department of Orthopaedic Surgery, Hosigaoka Kouseinenkin Hospital, Hirakata, Japan and 3 Department of Orthopaedic Surgery, Toyonaka Municipal Hospi...

Ngày tải lên: 10/08/2014, 10:20

7 298 0
Báo cáo Y học: Unique structural determinants in the signal peptides of ‘spontaneously’ inserting thylakoid membrane proteins pptx

Báo cáo Y học: Unique structural determinants in the signal peptides of ‘spontaneously’ inserting thylakoid membrane proteins pptx

... iPsbW, the forward and reverse primers were ATGGG TAAGAAGAAGGGAGGA and TCTCTTTGCTCGGA CGCG, respectively. For sPsbW, the forward and reverse primers were ATGGAGACAAAGCAAGGAAAC and TCTCTATTTGCTCGGACGCG. ... preceding A1 and A2 . The TPP cleavage sites are denoted by asterisks. The approximate cleavage site between the C-terminus of A1 and the signal peptide of...

Ngày tải lên: 18/03/2014, 01:20

11 484 0
Báo cáo y học: "Put your heart into the joint benefits of statins" pps

Báo cáo y học: "Put your heart into the joint benefits of statins" pps

... Therapy Vol 5 No 4 Hall The recognition that systemic inflammatory diseases are associated with accelerated atherosclerosis offers the prospect of reducing morbidity and mortality of affected patients ... farnesyl pyrophosphate and geranylgeranyl pyrophosphate, which are required for post-translational prenylation of a range of moieties, including signalling intermediaries,...

Ngày tải lên: 09/08/2014, 01:23

3 298 0
Báo cáo y học: " An ethnozoological study in the adjoining areas of Mount Abu wildlife sanctuary, India." docx

Báo cáo y học: " An ethnozoological study in the adjoining areas of Mount Abu wildlife sanctuary, India." docx

... 6:6 http://www.ethnobiomed.com/content/6/1/6 Page 6 of 8 The Garasiya tribe The Garasiya people are main inhabitant of surround- ings areas of the Mount Abu wildlife sanctuary, Pind- wara and Aburoad tehsil of Sirohi district of Rajasthan. Earlier ... of frog, honey, mi lk of goat, and ash of peacock feathers aresomeofthem.Goat(Capra aegagrus hircus )and honey bee (...

Ngày tải lên: 10/08/2014, 09:20

8 550 0
Báo cáo y học: "Quantitative gait analysis as a method to assess mechanical hyperalgesia modulated by disease-modifying antirheumatoid drugs in the adjuvant-induced arthritic rat" pps

Báo cáo y học: "Quantitative gait analysis as a method to assess mechanical hyperalgesia modulated by disease-modifying antirheumatoid drugs in the adjuvant-induced arthritic rat" pps

... rheumatoid arthritis in spite of their systemic, gastric and renal toxicities [5-11]. These cur- rently available analgesic and anti-inflammatory drugs are clearly not adequate therapy. In addition ... speed. Statistical analysis Statistical Package for the Social Sciences software (SPSS Inc. Chicago, IL, USA) was used to analyze the data. Through- out the study, the mean ± stan...

Ngày tải lên: 09/08/2014, 10:21

7 569 0
Báo cáo y học: "kết quả can thiệp tim mạch Tại khoa nội 2 bệnh viện 103 " pot

Báo cáo y học: "kết quả can thiệp tim mạch Tại khoa nội 2 bệnh viện 103 " pot

... congenital heart diseases 10, atrial septal defect 3 and 1 hypertrophic obstructive cardiomyopathy patient. Complications have been reported: hematoma at local vascular in 14 patients (2.7%), vagus ... 2 patients (0.4%) and death in 3 patients (0.6%). The study suggested that the interventional techniques were feasible and effective for patients. * Key words: Coronary angiography...

Ngày tải lên: 07/08/2014, 00:23

5 539 0
Báo cáo y học: "Quantitative expression of osteopontin in nasal mucosa of patients with allergic rhinitis: effects of pollen exposure and nasal glucocorticoid treatment" pdf

Báo cáo y học: "Quantitative expression of osteopontin in nasal mucosa of patients with allergic rhinitis: effects of pollen exposure and nasal glucocorticoid treatment" pdf

... pro- vides the first example of the distribution in the nasal mucosa of AR patients. The expression of OPN protein in the nasal mucosa of healthy and AR subjects was predomi- nantly in the nucleus of the ... quantitative imaging software (Leica QWin) with the same threshold used for all sections. The data was expressed as a percentage of total tissue area. Gr...

Ngày tải lên: 08/08/2014, 21:20

4 404 0
Báo cáo y học: " Quantitative biomarker analysis of synovial gene expression by real-time PCR" potx

Báo cáo y học: " Quantitative biomarker analysis of synovial gene expression by real-time PCR" potx

... target tissue. The use of a cellular standard generated with activated PBMC cDNA significantly improves assay reliability by reducing variation and by simplifying assay development. Analysis of ... or the amount was correlated to the standard curve generated on the same day. The CV was then calculated for the five separate runs. Figure 3a shows the CV for replicate assa...

Ngày tải lên: 09/08/2014, 01:23

9 557 0
Báo cáo y học: "Quantitative ultrasonic assessment for detecting microscopic cartilage damage in osteoarthritis" pptx

Báo cáo y học: "Quantitative ultrasonic assessment for detecting microscopic cartilage damage in osteoarthritis" pptx

... methods of the cartilage samplesSchematic illustration of the articular cartilage analysis and measure- ment methods of the cartilage samples. A reflex echogram of articular cartilage and a wavelet ... calculated automatically by a compu- ter. Articular cartilage was evaluated in vivo and in vitro with these two indices. Figure 1 Schematic illustration of...

Ngày tải lên: 09/08/2014, 06:22

9 336 0
w