Báo cáo y học: "β Transforming growth factor-β-induced regulatory T cells referee inflammatory and autoimmune diseases" potx
Báo cáo y học: "β Transforming growth factor-β-induced regulatory T cells referee inflammatory and autoimmune diseases" potx
... as
developmentally regulated, but it seems to be constitutive
and relatively stable. Recruitment to a site of autoimmune
reactivity may increase their numbers locally, but in a
limited fashion. The ability ... pathways await further study. Among the factors that
contribute to the regulation of TGF-β in CD4
+
CD25
+
Treg
are CD28, cytotoxic T lymphocyte antigen-4,
glucocorticoid-induced...
Báo cáo y học: "The expansion of CD4+CD28– T cells in patients with rheumatoid arthritis" potx
... association of CD4
+
CD28
–
T cells with disease
status has given rise to the hypothesis that these cells
directly contribute to disease manifestations. Patients with
nodulosis and extra-articular ... in the absence of a costimulatory
pathway.
CD4
+
CD28
–
T cells contribute to the cell infiltrate and
exhibit increased survival after apoptotic stimuli. Resis-
tance to apoptosis...
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot
... others
observed that this cytokine protected T cells from apopto-
sis [50,51]. We favor the hypothesis that TGF-β promotes
the death of mature Th1 and Th2 cells while protecting
newly generated regulatory T ... has the potential to prevent the rejection of allogeneic transplants.
Keywords: autoimmunity, IL-2, regulatory T cells, systemic lupus erythematosus, transforming g...
Báo cáo y học: " Hepatocyte growth factor prevents lupus nephritis in a murine lupus model of chronic graft-versus-host disease" ppt
... hepatocyte growth factor (HGF) on host B cell activation and donor anti-host cytotoxic T lymphocyte (CTL) activityEffect of hepatocyte growth factor (HGF) on host B cell activation and donor anti-host ... involve the protection of target
organs from injury through anti-apoptotic effects and the inhi-
bition of subsequent inflammatory cytokine reactions [16]. In
the present study...
Báo cáo y học: "Hepatocyte growth factor ameliorates dermal sclerosis in the tight-skin mouse model of scleroderma" doc
... TGGAGCTGAAGCAATAGTTGGTATC-
CAGGGCT.
3. β-actin, TGTGATGGTGGGAATGGGTCAG and TTTGAT-
GTCACGCACGATTTCC.
Mixed lymphocyte reaction (MLR) and in-vitro cytokine
production
CD4
+
T cells and CD11c
+
dendritic ... β-actin. The primer sequences
used were as follows:
1. IL-4, CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG
and CAGTGATGAGGACTTGGACTCATTCATGGTGC.
2. TGF-β1, TGGACCGCAACAACGCCATCTATGA-
GAAAA...
Báo cáo y học: "Nerve growth factor and receptor expression in rheumatoid arthritis and spondyloarthritsi" potx
... intracellular
detection of nerve growth factor (NGF). The cells were analysed by flow cytometry after setting lymphocyte (left column) and monocyte (right col-
umn) gates according to forward scatter vs ... arthritis.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
CB performed the RT-PCR experiments, the analysis of the
data,...
Báo cáo y học: "Tumor necrosis factor α-induced adipose-related protein expression in experimental arthritis and in rheumatoid arthritis" pptx
... of TNFα antagonists in autoimmune arthritis, suggesting
that TIARP plays an important role in inflammatory arthritis,
through the regulation of inflammatory cytokines.
Introduction
Rheumatoid ... GPI-induced arthritis, both TNFα and
IL-6 antagonists have protective effects [3,4], and these
cytokines play important roles in the induction of arthritis in col-
Arthritis Research &...
Báo cáo sinh học: " Fibroblast growth factor 2 orchestrates angiogenic networking in non-GIST STS patients" potx
... scored the cores. TK and TD did the
statistical analysis. TK drafted the manuscript. All authors read and approved
the final manuscript.
Competing interests
The authors declare that they have ... contributions
All authors participated in the study design, result interpretation and in the
writing. TK, AV, SS and ES contributed in making the clinical and
demographic database. TK, SS...
Báo cáo y học: "Reduced proportions of natural killer T cells are present in the relatives of lupus patients and are associated with autoimmunity" ppt
... Medicine and Immunology, University of Toronto, Bathurst Street, Toronto, Ontario, M 5T 2S8, Canada
2
Toronto Western Hospital Research Institute, University Health Network, Bathurst Street, Toronto, ... observation that the reduced proportion of
NKT cells in first-degree relatives is independently and addi-
tively associated with positive ANA status and autoimmune
disease strongly...
Báo cáo y học: "Heat shock protein 60 reactive T cells in juvenile idiopathic arthritis: what is ne" pdf
... patients
could be attributed to the Tregs themselves: the amount of
Tregs may be insufficient, or the supposed Tregs may actually
be activated effector T cells that express FOXP3 transiently
[70]. ... and
pathogenic patterns to ensure that they enhance only the
tolerogenic effect and do not tip the delicate immune balance
towards inflammation.
Competing interests
The authors declare t...
Từ khóa: