Báo cáo y học: "β Transforming growth factor-β-induced regulatory T cells referee inflammatory and autoimmune diseases" potx

Báo cáo y học: "β Transforming growth factor-β-induced regulatory T cells referee inflammatory and autoimmune diseases" potx

Báo cáo y học: "β Transforming growth factor-β-induced regulatory T cells referee inflammatory and autoimmune diseases" potx

... as developmentally regulated, but it seems to be constitutive and relatively stable. Recruitment to a site of autoimmune reactivity may increase their numbers locally, but in a limited fashion. The ability ... pathways await further study. Among the factors that contribute to the regulation of TGF-β in CD4 + CD25 + Treg are CD28, cytotoxic T lymphocyte antigen-4, glucocorticoid-induced...

Ngày tải lên: 09/08/2014, 06:22

7 311 0
Báo cáo y học: "The expansion of CD4+CD28– T cells in patients with rheumatoid arthritis" potx

Báo cáo y học: "The expansion of CD4+CD28– T cells in patients with rheumatoid arthritis" potx

... association of CD4 + CD28 – T cells with disease status has given rise to the hypothesis that these cells directly contribute to disease manifestations. Patients with nodulosis and extra-articular ... in the absence of a costimulatory pathway. CD4 + CD28 – T cells contribute to the cell infiltrate and exhibit increased survival after apoptotic stimuli. Resis- tance to apoptosis...

Ngày tải lên: 09/08/2014, 01:22

4 400 0
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

... others observed that this cytokine protected T cells from apopto- sis [50,51]. We favor the hypothesis that TGF-β promotes the death of mature Th1 and Th2 cells while protecting newly generated regulatory T ... has the potential to prevent the rejection of allogeneic transplants. Keywords: autoimmunity, IL-2, regulatory T cells, systemic lupus erythematosus, transforming g...

Ngày tải lên: 09/08/2014, 03:24

6 409 0
Báo cáo y học: " Hepatocyte growth factor prevents lupus nephritis in a murine lupus model of chronic graft-versus-host disease" ppt

Báo cáo y học: " Hepatocyte growth factor prevents lupus nephritis in a murine lupus model of chronic graft-versus-host disease" ppt

... hepatocyte growth factor (HGF) on host B cell activation and donor anti-host cytotoxic T lymphocyte (CTL) activityEffect of hepatocyte growth factor (HGF) on host B cell activation and donor anti-host ... involve the protection of target organs from injury through anti-apoptotic effects and the inhi- bition of subsequent inflammatory cytokine reactions [16]. In the present study...

Ngày tải lên: 09/08/2014, 08:22

9 463 0
Báo cáo y học: "Hepatocyte growth factor ameliorates dermal sclerosis in the tight-skin mouse model of scleroderma" doc

Báo cáo y học: "Hepatocyte growth factor ameliorates dermal sclerosis in the tight-skin mouse model of scleroderma" doc

... TGGAGCTGAAGCAATAGTTGGTATC- CAGGGCT. 3. β-actin, TGTGATGGTGGGAATGGGTCAG and TTTGAT- GTCACGCACGATTTCC. Mixed lymphocyte reaction (MLR) and in-vitro cytokine production CD4 + T cells and CD11c + dendritic ... β-actin. The primer sequences used were as follows: 1. IL-4, CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG and CAGTGATGAGGACTTGGACTCATTCATGGTGC. 2. TGF-β1, TGGACCGCAACAACGCCATCTATGA- GAAAA...

Ngày tải lên: 09/08/2014, 08:22

7 399 0
Báo cáo y học: "Nerve growth factor and receptor expression in rheumatoid arthritis and spondyloarthritsi" potx

Báo cáo y học: "Nerve growth factor and receptor expression in rheumatoid arthritis and spondyloarthritsi" potx

... intracellular detection of nerve growth factor (NGF). The cells were analysed by flow cytometry after setting lymphocyte (left column) and monocyte (right col- umn) gates according to forward scatter vs ... arthritis. Competing interests The authors declare that they have no competing interests. Authors' contributions CB performed the RT-PCR experiments, the analysis of the data,...

Ngày tải lên: 09/08/2014, 14:21

9 349 0
Báo cáo y học: "Tumor necrosis factor α-induced adipose-related protein expression in experimental arthritis and in rheumatoid arthritis" pptx

Báo cáo y học: "Tumor necrosis factor α-induced adipose-related protein expression in experimental arthritis and in rheumatoid arthritis" pptx

... of TNFα antagonists in autoimmune arthritis, suggesting that TIARP plays an important role in inflammatory arthritis, through the regulation of inflammatory cytokines. Introduction Rheumatoid ... GPI-induced arthritis, both TNFα and IL-6 antagonists have protective effects [3,4], and these cytokines play important roles in the induction of arthritis in col- Arthritis Research &...

Ngày tải lên: 09/08/2014, 14:22

11 444 0
Báo cáo sinh học: " Fibroblast growth factor 2 orchestrates angiogenic networking in non-GIST STS patients" potx

Báo cáo sinh học: " Fibroblast growth factor 2 orchestrates angiogenic networking in non-GIST STS patients" potx

... scored the cores. TK and TD did the statistical analysis. TK drafted the manuscript. All authors read and approved the final manuscript. Competing interests The authors declare that they have ... contributions All authors participated in the study design, result interpretation and in the writing. TK, AV, SS and ES contributed in making the clinical and demographic database. TK, SS...

Ngày tải lên: 18/06/2014, 19:20

8 274 0
Báo cáo y học: "Reduced proportions of natural killer T cells are present in the relatives of lupus patients and are associated with autoimmunity" ppt

Báo cáo y học: "Reduced proportions of natural killer T cells are present in the relatives of lupus patients and are associated with autoimmunity" ppt

... Medicine and Immunology, University of Toronto, Bathurst Street, Toronto, Ontario, M 5T 2S8, Canada 2 Toronto Western Hospital Research Institute, University Health Network, Bathurst Street, Toronto, ... observation that the reduced proportion of NKT cells in first-degree relatives is independently and addi- tively associated with positive ANA status and autoimmune disease strongly...

Ngày tải lên: 09/08/2014, 13:21

13 451 0
Báo cáo y học: "Heat shock protein 60 reactive T cells in juvenile idiopathic arthritis: what is ne" pdf

Báo cáo y học: "Heat shock protein 60 reactive T cells in juvenile idiopathic arthritis: what is ne" pdf

... patients could be attributed to the Tregs themselves: the amount of Tregs may be insufficient, or the supposed Tregs may actually be activated effector T cells that express FOXP3 transiently [70]. ... and pathogenic patterns to ensure that they enhance only the tolerogenic effect and do not tip the delicate immune balance towards inflammation. Competing interests The authors declare t...

Ngày tải lên: 09/08/2014, 14:20

10 353 0
Từ khóa:
w