Báo cáo y học: "The role of regulatory T cells in antigen-induced arthritis: aggravation of arthritis after depletion and amelioration after transfer of CD4+CD25+ T cells" doc
Báo cáo y học: "The role of regulatory T cells in antigen-induced arthritis: aggravation of arthritis after depletion and amelioration after transfer of CD4+CD25+ T cells" doc
... 2Research articleThe role of regulatory T cells in antigen-induced arthritis: aggravation of arthritis after depletion and amelioration after transfer of CD4+CD25+ T cells Oliver Frey1, Peter ... With this in mind, itcould be interesting to investigate whether the accumu-lated T reg cells in patients with arthritis function properly in vivo and whether these patients could really benefit ... correct, then they could explainwhy the transfer of T reg cells after arthritis induction is noteffective. On the one hand, transfer of T reg cells 24 hours after intra-articular antigen...
- 11
- 440
- 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf
... CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTACReverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGCQ76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTGReverse CCTCATTTCCTCCGGGAAGACTTTTGAATA CN77G Forward CGGACAAGGTGAGGACTTGGTACTTACTGGATACReverse ... contains threedomains resembling family 2 cystatins.Cystatins competitively inhibit the activity of papain-like cysteine proteases by binding to the active site of thelatter and forming a tight, ... ForwardGCTCAGGCGACCATGGGCCATCATCATCReverse CTTGCATGCCCTGCAGGTCGMutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTGReverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATTP74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTACReverse...
- 10
- 533
- 0
Báo cáo Y học: The role of hydrophobic active-site residues in substrate specificity and acyl transfer activity of penicillin acylase pdf
... volume of the acyl binding pocket and thereby alter the binding mode and affinity of theenzyme for PAA and derivatives thereof, while maintainingthe hydrophobicity of the binding site.To test the ... effect of the mutations on the specificity forphenylacetylated substrates, the steady-state kinetic param-eters for the hydrolysis of the chromogenic substrateNIPAB and the inhibition constant of ... thephenylalanines in the active site suggesting that hydropho-bic interactions between the aromatic phenylalanines and the phenyl ring of the substrate play an important role in substrate binding....
- 8
- 561
- 0
Báo cáo Y học: The role of zinc in the methylation of the coenzyme M thiol group in methanol:coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy doc
... finding that both MtaA mutants still bindcoenzyme M and exhibit some activity although in bothmutants the coordination of zinc differs from the situation in the wild-type enzyme. Apparently, other ... apparentabsence of any sulfur in the first coordination sphere of Zn in the Cys239 fi Ala mutant suggests that Cys316 is not adirect Zn ligand in MtaA. It would be interesting toinvestigate the ... 5ÂCGTGACTGTACTCCACATCgcTGGTAAGGTTAACGC (sense) and 5ÂGCGTTAACCTTACCAgcGATGTGGAGTACAGTCACG (antisense). The mutated bases are given in lower-caseletters. The mutated mtaA genes were obtained by...
- 7
- 464
- 0
Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx
... [12,13]suggest that correct orientation of the penicillin substratewith respect to the putative high-energy ferryl intermediateis important for optimum coupling between 2-oxoglutarate and penicillin ... substrate, and may be a consequence of the higher Kmvalue for this substrate [1,22]. The third type of mutant,represented by arginines 306 and 307, are located in theC-terminus. They appear to ... peni-cillin substrates is a desirable objective, as this may allowfermentation of starting materials for production of semi-synthetic cephem antibiotics. The results in this papersuggest that point...
- 5
- 462
- 0
Báo cáo y học: "The role of Probiotics in allergic diseases" pptx
... as the timing of theintroduction of the probiotic, Taylor et al administeredthe probiotic supplement postnatally, while other studiesadministered probiotics before and after birth. Prenatalsupplementation ... in allergic disordersThe interest in probiotic therapeutic potential in allergicdisorders stemmed from the fact that they have beenshown to reduce inflammatory cytokines and improveintestinal ... family history of eczema,allergic rhinitis or asthma, and to their infants for the firstsix months after delivery. The frequency of developingatopic dermatitis in the offspring was significantlyreduced...
- 7
- 560
- 0
Báo cáo y học: "The role of cyclooxygenase-2 in bone repair" doc
... chal-lenging. The recruitment of sufficient numbers of patientsto achieve statistical power, the development of reliablemethods to measure the bone repair endpoint, and therandomization of patients ... thedoses of indomethacin and celecoxib used in the ratswere roughly equivalent to those used in patients, thedose of rofecoxib was nearly eight times that used tomanage inflammation and four times ... times that used to manageacute pain. Moreover, whereas the use of these drugs in the management of acute pain is typically short term (afew days to two weeks), their continuous usage in theseexperiments...
- 3
- 475
- 0
Báo cáo y học: "The role of hypoxia and HIF-dependent signalling events in rheumatoid arthritis" ppt
... of α-subunits, and two transactivating domains, namely theamino-terminal transactivating domain and the carboxyl-terminal transactivating domain (C-TAD). The C-TAD hasbeen shown to interact with co-activators ... proteins, and the intracellulardomain of the Notch receptor (involved in the maintenance of cells in an undifferentiated state), both of which notablycontain ankyrin repeat motifs containing the ... hydroxylation [28]. Hydroxylation occurs at theβ-carbon of the asparagine residue, consequently (by way of steric hindrance) preventing the interaction of the HIF-αC-TAD with the cysteine/histidine-rich...
- 9
- 499
- 0
Báo cáo y học: "The role of osteoprotegerin in arthritis" ppsx
... of TNF-α and IL-1 are other currently usedstrategies. Both cytokines are potent osteoclastogenicfactors, produced in inflammatory arthritis. Interestingly,clinical trials have shown that the ... 242Osteoprotegerin as inhibitor of osteoclastogenesisOsteoprotegerin (OPG) has emerged as one of the mostattractive tools to inhibit osteoclast formation during thepast years. The interaction of ... Nagashima M, Yamamoto M, Nishijima T, KatsumataS, Yoshino S: Bone resorption and inflammatory inhibition effi-cacy of intermittent cyclical etidronate therapy in rheumatoid arthritis. J Rheumatol 2003,...
- 7
- 343
- 0
Báo cáo y học: "The role of statins as potential targets for bone formation" pptx
... apposition rate in the tibiae of ratstreated with cerivastatin at 0.1 mg/kg/day. Statins, there-fore, have the potential to stimulate bone formation both in vitro and in vivo in rats. Cerivastatin ... localproduction of the osteogenic protein BMP-2. Interestingly,pravastatin was unable to stimulate the BMP-2 promoteractivity and it did not stimulate new bone formation in neonatal murine calvaria. In ... associated with increased expression of the BMP-2 gene in bone cells [11]. In vitroeffectsSimvastatin, mevastatin and atorvastatin (but not pravas-tatin) were found to have identical effects to those...
- 4
- 392
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenthe role of newer technologies csii and cgm and novel strategies in the management of type 1 diabetes for sport and exercisethe role of clinical pathologic correlation and use of cytologic preparations in intraoperative neuropathology consultationthe role of large volume liposuction and other adjunctive procedures pdfthe role of covert policing asserted and actualdefining the role of identity self concepts and lifestylethe role of cytokines during initiation and perpetuation of the diseasethe role of chronic vascular remodeling and adventitiathe role of race socioeconomic status and the urban environmentthe role of trauma memory neurobiology and the self in the formation of personality disordersthe role of health information technology and data system integration in the collection of hiv care dataMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngThơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ