Báo cáo y học: "Increased interleukin-17 production via a phosphoinositide 3-kinase/Akt and nuclear factor κB-dependent pathway in patients with rheumatoid arthritis" ppt
Báo cáo y học: "Augmented low-Dye tape alters foot mobility and neuromotor control of gait in individuals with and without exercise related leg pain" docx
... reduc-tion in MG activation, and a small increase in PLactivation with application of ALD tape. This supportspreliminary findings of tape-induced reductions in TP and TA activation in a small cohort ... conception and design, carried out acquisition of data,performed analysis and interpretation of data and drafted the manuscript.ARC contributed to conception and design, assisted with analysis and interpretation ... running, and warrantsfurther investigation of ALD tape as an intervention in this context.ALD tape produced a large increase in arch height and large reductions in vertical and medio-lateral mid-foot...
- 9
- 355
- 0
Báo cáo y học: "Decreased metalloproteinase production as a response to mechanical pressure in human cartilage: a mechanism for homeostatic regulatio" pps
... fromanimals cannot always be extrapolated to humans. Bjelle [36]has analysed the mechanical response of human knees and found an increase in glycosaminoglycan production in load-bearing areas. ... of aggrecan and type II collagen in OF and OA cartilage. Ratio of aggrecan to type II collagen in the cartilage matrix of OA and OF femoral heads and comparison between areas (SP and IP). Aggrecan ... joint loads influence proteinase expression,which could modify the balance between aggrecan and type IIcollagen.Figure 4Analysis of aggrecan and type II collagen in OF and OA cartilageAnalysis...
- 11
- 520
- 0
Báo cáo y học: "Randomized trial comparing daily interruption of sedation and nursing-implemented sedation algorithm in medical intensive care unit patients"
... the initial strategy[8]. In the recently published Awakening and Breathing Con-ABC = Awakening and Breathing Controlled; ANOVA = analysis of variance; APACHE = Acute Physiology and Chronic Health ... Bernard GR, Ely EW: Efficacy and safetyof a paired sedation and ventilator weaning protocol formechanically ventilated patients in intensive care (awakening and breathing controlled trial): a ... data analysis and interpretation, and drafting of the manuscript. WIJ partici-pated in data acquisition and drafting of the manuscript. SKEparticipated in study conception, study design, data...
- 9
- 605
- 0
Báo cáo y học: "Low socio-economic status, smoking, mental stress and obesity predict obstructive symptoms in women, but only smoking also predicts subsequent experience of poor health"
... data concerning lung function, airway symptoms and health status in those women who were 38 years old at the initial examination and 70 years old at the 32-year follow up in 2000-2001. As ... All participants in the population study were physically examined and interviewed by physicians and research nurses. Information concerning education and socio-economic group was obtained ... was obtained by questionnaire, which was sent out beforehand. Data on smoking habits and pulmonary disease was obtained via an interview with a physician. Socio-economic group in 1968-1969;...
- 6
- 505
- 0
Báo cáo khoa học: Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger docx
... were as described previously[29]. Shake flask cultures for preliminary characterization(Southern analysis, transcript analysis and enzyme activity) and screening of isolated transformants contained ... Genetic Analyser, Perkin Elmer). tktA wassequenced by ligating the gene into pUC19 and using33P-labelled ddNTPs (Amersham-Pharmacia, Piscataway,NJ) by standard methods [35,36] covering all parts ... Glycolysis, pentose phosphate pathway and polyol formation and degradation in Aspergilli. Partly after [50] and [51]. Enzymes in boxes were subjected to metabolic engineering in this study. Metabolites...
- 13
- 382
- 0
Báo cáo y học: "Synovial histopathology of psoriatic arthritis, both oligo- and polyarticular, resembles spondyloarthropathy more than it does rheumatoid arthritis" pot
... PsA is generally characterized byneovascularization, and inflammatory infiltration with predomi-nantly mononuclear cells (T lymphocytes, B lymphocytes and plasma cells, and macrophages), although ... tissues[16,19].After incubation with the primary antibody, sections weresequentially incubated with a biotinylated second antibody, a streptavidine–horseradish peroxidase link, and finally with amino-ethyl-carbazole ... (USpA) and RA, and compared the synovium of oligoarticular versus polyarticularPsA. Synovial biopsies were obtained from patients with RA,nonpsoriatic SpA (AS + USpA), and oligoarticular and polyarticular...
- 12
- 308
- 0
Báo cáo y học: "Differential gene expression of bone anabolic factors and trabecular bone architectural changes in the proximal femoral shaft of primary hip osteoarthritis patients" pptx
... Data are expressed as parametric mean ± standard devi-ation (open diamond) and non-parametric median (closed diamond) and quartile (dash) range. COL 1A, collagen type I alpha chain; GAPDH, glycer-aldehyde-3-phosphate ... GTCAGCCAACTCGTCACAGTCCOPNSense AGCCGTGGGAAGGACAGTTATG 472 62 29 NM_000582Antisense GAGTTTCCATGAAGCCACAAACIGF-ISense GAGCCTGCGCAATGGAATAAAG 344 62 33 NM_000618Antisense CCTGTCTCCACACACGAACTGIGF-IISense GAGGAGTGCTGTTTCCGCAG ... Mohan S, Finkelman RD, Aerssens J, Baylink DJ: Gen-eralized osteoarthritis associated with increased insulin-likegrowth factor types I and II and transforming growth factor beta in cortical...
- 12
- 421
- 0
Báo cáo y học: "Diacerein inhibits the synthesis of resorptive enzymes and reduces osteoclastic differentiation/survival in osteoarthritic subchondral bone: a possible mechanism for a protective effect against subchondral bone remodelling" ppsx
... design, analysis and interpretation of data,manuscript preparation, and statistical analysis. SKT partici-pated in acquisition of data, analysis and interpretation of data, and manuscript preparation. ... of data, manuscript preparation, and statis-tical analysis. J-PP participated in study design, analysis and interpretation of data, and manuscript preparation. JM-P par-ticipated in study design, ... signaling by acidosis and receptor activator of NF-kappaB ligand (RANKL) on the calcium/calcineurin/NFAT pathway in osteoclasts. Proc Natl Acad Sci USA 2005,102:2643-2648.Available online...
- 10
- 536
- 0
Báo cáo y học: "Preoperative ejection fraction as a predictor of survival after coronary artery bypass grafting: comparison with a matched general population" docx
... afterCABG in patients with an EF of ≤ 20%: a chief complaintof only pain, unstable angina, and a Canadian and NewYork Heart Association class lower than IV.Case selection has been shown to be an ... was that preoperative EF is a statistically significant predictor for higher rates of early and late mortality after CABG. Patients with a low EF hadTable 3: Early and late mortality according ... 74(5):1531-1536.12. Topkara VK, Cheema FH, Kesavaramanujam S, Mercando ML, Cheema AF, Namerow PB, Argenziano M, Naka Y, Oz MC, Esrig BC: Coronary artery bypass grafting in patients with low ejection fraction....
- 8
- 358
- 0
Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx
... seriesdue to ARDS. Mitchell et al [8] reported a 20% mortalityfor Carinal Pneumonectomy and 11% for carinal plasty.The overall mortality is high and this could be explainedby looking at the patients ... removed with R middle & lower lobectomy 5 years ago.CP: carinal plasty with reinplantation of the right main bronchus to the trachea for Tracheal Sarcoma (TS) or carcinoid tumor A: AliveD:DeadParissis ... 121:465-71.9. Macchiarini P, Altmayer M, Go T, Walles T, Schulze K, Wildfang I, Haverich A, Hardin M: Hannover Interdisciplinary Intrathoracic Tumor Task Force Group. Technical innovations of carinal resection...
- 7
- 311
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật