Báo cáo y học: "Increased interleukin-17 production via a phosphoinositide 3-kinase/Akt and nuclear factor κB-dependent pathway in patients with rheumatoid arthritis" ppt
Báo cáo y học: "Augmented low-Dye tape alters foot mobility and neuromotor control of gait in individuals with and without exercise related leg pain" docx
... reduc- tion in MG activation, and a small increase in PL activation with application of ALD tape. This supports preliminary findings of tape-induced reductions in TP and TA activation in a small cohort ... conception and design, carried out acquisition of data, performed analysis and interpretation of data and drafted the manuscript. ARC contributed to conception and...
Ngày tải lên: 10/08/2014, 21:24
Báo cáo y học: "Decreased metalloproteinase production as a response to mechanical pressure in human cartilage: a mechanism for homeostatic regulatio" pps
... from animals cannot always be extrapolated to humans. Bjelle [36] has analysed the mechanical response of human knees and found an increase in glycosaminoglycan production in load- bearing areas. ... of aggrecan and type II collagen in OF and OA cartilage. Ratio of aggrecan to type II collagen in the cartilage matrix of OA and OF femoral heads and comparison between area...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Randomized trial comparing daily interruption of sedation and nursing-implemented sedation algorithm in medical intensive care unit patients"
... the initial strategy [8]. In the recently published Awakening and Breathing Con- ABC = Awakening and Breathing Controlled; ANOVA = analysis of variance; APACHE = Acute Physiology and Chronic Health ... Bernard GR, Ely EW: Efficacy and safety of a paired sedation and ventilator weaning protocol for mechanically ventilated patients in intensive care (awakening and breathing...
Ngày tải lên: 25/10/2012, 10:35
Báo cáo y học: "Low socio-economic status, smoking, mental stress and obesity predict obstructive symptoms in women, but only smoking also predicts subsequent experience of poor health"
... data concerning lung function, airway symptoms and health status in those women who were 38 years old at the initial examination and 70 years old at the 32-year follow up in 2000-2001. As ... All participants in the population study were physically examined and interviewed by physicians and research nurses. Information concerning education and socio-economic group was...
Ngày tải lên: 31/10/2012, 15:34
Báo cáo khoa học: Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger docx
... were as described previously [29]. Shake flask cultures for preliminary characterization (Southern analysis, transcript analysis and enzyme activity) and screening of isolated transformants contained ... Genetic Analyser, Perkin Elmer). tktA was sequenced by ligating the gene into pUC19 and using 33 P-labelled ddNTPs (Amersham-Pharmacia, Piscataway, NJ) by standard methods [35,36] coveri...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo y học: "Synovial histopathology of psoriatic arthritis, both oligo- and polyarticular, resembles spondyloarthropathy more than it does rheumatoid arthritis" pot
... PsA is generally characterized by neovascularization, and inflammatory infiltration with predomi- nantly mononuclear cells (T lymphocytes, B lymphocytes and plasma cells, and macrophages), although ... tissues [16,19]. After incubation with the primary antibody, sections were sequentially incubated with a biotinylated second antibody, a streptavidine–horseradish peroxidase lin...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Differential gene expression of bone anabolic factors and trabecular bone architectural changes in the proximal femoral shaft of primary hip osteoarthritis patients" pptx
... Data are expressed as parametric mean ± standard devi- ation (open diamond) and non-parametric median (closed diamond) and quartile (dash) range. COL 1A, collagen type I alpha chain; GAPDH, glycer- aldehyde-3-phosphate ... GTCAGCCAACTCGTCACAGTCC OPN Sense AGCCGTGGGAAGGACAGTTATG 472 62 29 NM_000582 Antisense GAGTTTCCATGAAGCCACAAAC IGF-I Sense GAGCCTGCGCAATGGAATAAAG 344 62 33 NM_000618 Anti...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: "Diacerein inhibits the synthesis of resorptive enzymes and reduces osteoclastic differentiation/survival in osteoarthritic subchondral bone: a possible mechanism for a protective effect against subchondral bone remodelling" ppsx
... design, analysis and interpretation of data, manuscript preparation, and statistical analysis. SKT partici- pated in acquisition of data, analysis and interpretation of data, and manuscript preparation. ... of data, manuscript preparation, and statis- tical analysis. J-PP participated in study design, analysis and interpretation of data, and manuscript preparation. JM-P par-...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "Preoperative ejection fraction as a predictor of survival after coronary artery bypass grafting: comparison with a matched general population" docx
... after CABG in patients with an EF of ≤ 20%: a chief complaint of only pain, unstable angina, and a Canadian and New York Heart Association class lower than IV. Case selection has been shown to be an ... was that preoperative EF is a statistically significant predictor for higher rates of early and late mortality after CABG. Patients with a low EF had Table 3: Early an...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx
... series due to ARDS. Mitchell et al [8] reported a 20% mortality for Carinal Pneumonectomy and 11% for carinal plasty. The overall mortality is high and this could be explained by looking at the patients ... removed with R middle & lower lobectomy 5 years ago. CP: carinal plasty with reinplantation of the right main bronchus to the trachea for Tracheal Sarcoma (TS) or carcinoi...
Ngày tải lên: 10/08/2014, 09:22