0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "A model of inflammatory arthritis highlights a role for oncostatin M in pro-inflammatory cytokine-induced bone destruction via RANK/RANK" pps

Báo cáo y học:

Báo cáo y học: "A model of inflammatory arthritis highlights a role for oncostatin M in pro-inflammatory cytokine-induced bone destruction via RANK/RANK" pps

... RANK/RANKL in inflammatory cells, in inflamed synovium, in artic-ular cartilage and at the invading front of bone erosions.It has been long recognized that pro -inflammatory cytokines are intimately ... online http:/ /arthritis- research.com/content/7/1/R57R57Vol 7 No 1Research article A model of inflammatory arthritis highlights a role for oncostatin M in pro -inflammatory cytokine-induced bone ... Kobayashi K, Takahashi N, Jimi E, Udagawa N, Takami M, KotakeS, Nakagawa N, Kinosaki M, Yamaguchi K, Shima N, et al.: Tumornecrosis factor alpha stimulates osteoclast differentiation by a mechanism...
  • 8
  • 380
  • 0
Báo cáo y học:

Báo cáo y học: " Experimental ablation of the pancreas with high intensity focused ultrasound (HIFU) in a porcine model"

... embedded in paraffin and stained with hematoxylin and eosin (H &E) for light microscopy (Olympus BH2, Olympus Corporation, Tokyo, Japan). 11Part of sam -ples were processed for and evaluated ... safety remains the main con -cern of any medical intervention of the pancreatic diseases. A previous preclinical in vivo study in swine demonstrated the feasibility and safety of H I FU for ... composed of three parts: a firing system located in a degassed water tank, an imaging system consisting of an ultrasound scanner coupled wi t h a sterotaxic localizing arm, and a computer-controlled...
  • 7
  • 481
  • 0
Báo cáo y học:

Báo cáo y học: "Clinical Management of Adult Patients with a History of Nonsteroidal Anti-Inflammatory Drug–Induced Urticaria/ Angioedema: Update" ppt

... presently very limited, includingonly nimesulide, paracetamol, and meloxicam. Third, theanti -inflammatory and/or analgesic activity of theseremaining substances (nimesulide, paracetamol, meloxi-cam) ... Patients with NSAID-Induced Urticaria/Angioedema 29ORIGINAL ARTICLEClinical Management of Adult Patients with a History of Nonsteroidal Anti -Inflammatory Drug–Induced Urticaria/Angioedema: ... nonsteroidal anti- inflammatory drug intolerance. J Allergy Clin Immunol 2001;107:557.41. Asero R. Aspirin and paracetamol tolerance in patients withnimesulide-induced urticaria. Ann Allergy Asthma...
  • 7
  • 487
  • 0
Báo cáo y học:

Báo cáo y học: "Altered expression of inflammatory cytokines in primary osteoarthritis by human T lymphotropic virus type I retrovirus infection: a cross-sectional study" pps

... M, Yoshida E, Takiguchi M, Sato K, Kitajima I,Nishioka K, Yamamoto K, Takeda T, Hatanaka M, Yamamoto H,Sekiguchi T: Induction of inflammatory arthropathy resemblingrheumatoid arthritis in mice ... carriers and 55 non-carrier patientsfelt pain in the medial femorotibial joints, a common type in Japanese primary OA, whereas the remaining patients alsocomplained of pain in the patellofemoral ... proliferation of synoviocytes in thesynovial lining layer, gross infiltration of lymphocytes, andmigration of atypical lymphocytes with nuclear indentationinto the synovial fluid (SF) and/or synovial...
  • 8
  • 601
  • 0
Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot

... C-terminal amino acids of CNTF-R (amino acids 331–346) that are not part of themembrane-proximal cytokine binding domain [33] and the14 N-terminal nonhelical and presumably flexible aminoacids of ... T., Hibi, M. , Yamanaka, Y. , Takahashi Tezuka, M. ,Fujitani, Y. , Yamaguchi, T., Nakajima, K. & Hirano, T. (1996)Two signals are necessary for cell proliferation induced by a cytokine receptor ... 2002STAT3 and MAPK activation by Hyper-CNTF in transfected BAF/3 cellsDownstream signal transduction pathways were analyzedby studying the activation level of JAK/STAT and MAPkinase signaling...
  • 9
  • 442
  • 0
Báo cáo y học:

Báo cáo y học: "Stigmatising attitude of medical students towards a psychiatry label." pot

... NigeriaEmail: Olawale O Ogunsemi* - waleogunsemi@yahoo.com; Olatunde Odusan - tunsan2001@yahoo.com; Michael O Olatawura - dareolatawura@yahoo.com* Corresponding author AbstractBackground: The aim ... medical students towards a psychiatry labelOlawale O Ogunsemi*, Olatunde Odusan and Michael O OlatawuraAddress: Olabisi Onabanjo University Teaching Hospital, Sagamu, Ogun State, NigeriaEmail: ... Psychiatry 1996, 31:382-90.25. Tan SM, Azmi MT, Reddy JP, Shaharom MH, Rosdinom R, Maniam T,Ruzanna ZZ, Minas IH: Does clinical exposure to patients in medical school affect trainee doctors'...
  • 4
  • 347
  • 0
Báo cáo y học:

Báo cáo y học: "The abilities of improved schizophrenia patients to work and live independently in the community: a 10-year long-term outcome study from Mumbai, India" ppsx

... community: a 10-year long-term outcome study from Mumbai, IndiaAmresh Kumar Srivastava*1,5, Larry Stitt2, Meghana Thakar1, Nilesh Shah3 and Gurusamy Chinnasamy4Address: 1Mental Health ... Ontario, CanadaEmail: Amresh Kumar Srivastava* - amresh.edu@gmail.com; Larry Stitt - Larry.Stitt@schulich.uwo.ca; Meghana Thakar - meghana2711@yahoo.co.uk; Nilesh Shah - psysion@vsnl.com; Gurusamy ... Foundation of India (PRERANA Charitable Trust) and Silver Mind Hospital, Mumbai, Maharashtra, India, 2Department of Epidemiology & Biostatistics, Schulich School of Medicine & Dentistry,...
  • 8
  • 511
  • 0
Báo cáo y học:

Báo cáo y học: "Regional assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis" pptx

... assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritisAllan A Young1, Margaret M Smith1, Susan M Smith1, Martin A Cake2, Peter ... in place of authentic primaryantibody.RNA extractionApproximately 100 mg of frozen cartilage samples was frag-mented in a Mikro-Dismembrator (Braun Biotech International,Melsungen, Germany), ... TGCACGACGAGGTCCTCACTAF019758Decorin 55 319 F CAAACTCTTTTGCTTGGGCTR CACTGGACAACTCGCAGATGAF125041Biglycan 65 204 F CCATGCTGAACGATGAGGAAR CATTATTCTGCAGGTCCAGCAF034842Fibromodulin 65 442 F CTGGACCACAACAACCTGACR...
  • 10
  • 416
  • 0
Báo cáo y học:

Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx

... K, Kinsey SE, Markham AF, EmeryP, McGonagle D: Enumeration and phenotypic characteriza-tion of synovial fluid multipotential mesenchymal progenitorcells in inflammatory and degenerative arthritis. ... MSC-induced immunosuppression may fosterthe growth of tumours, as exemplified in a murine melanoma model [4]. A platform model for cellular therapy research and applicationwas presented by Constantino ... inflammatory and scarringtissue damage is often present.On the other hand, MSCs may also actively participate in initiating AD [3], they have the potential to favour spread of melanoma metastases...
  • 10
  • 559
  • 0
Báo cáo y học:

Báo cáo y học: "Extracellular localization of galectin-3 has a deleterious role in joint tissues" docx

... CAGTGTTGGCTGAGTGAAAGAGACCC284Osteocalcin S: CATGAGAGCCCTCACAAS: AGAGCGACACCCTAGAC310 [48]Alkaline phosphatase S: TGCAGTACGAGCTGAACAGAS: TGAAGACGTGGGAATGGTC267Type I collagen α1 chain S: CCGAAGGTTCCCCTGGACGAAS: ... [39].Osteocalcin determinationThe assay measured only intact human osteocalcin and wasperformed on human osteoblast-conditioned media using a specific enzyme immunoassay (EIA) kit with a sensitivity of ... particularly during inflammatory phases. Very often, these phases lead to hyperplasia of thesynovium, which may invade the joint space and adhere to car-tilage, generating a pannus. This pannus...
  • 9
  • 351
  • 0

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)