Báo cáo y học: "A model of inflammatory arthritis highlights a role for oncostatin M in pro-inflammatory cytokine-induced bone destruction via RANK/RANK" pps
Báo cáo y học: "A model of inflammatory arthritis highlights a role for oncostatin M in pro-inflammatory cytokine-induced bone destruction via RANK/RANK" pps
... RANK/ RANKL in inflammatory cells, in inflamed synovium, in artic- ular cartilage and at the invading front of bone erosions. It has been long recognized that pro -inflammatory cytokines are intimately ... online http:/ /arthritis- research.com/content/7/1/R57 R57 Vol 7 No 1 Research article A model of inflammatory arthritis highlights a role for oncostatin M...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: " Experimental ablation of the pancreas with high intensity focused ultrasound (HIFU) in a porcine model"
... embedded in paraffin and stained with hematoxylin and eosin (H &E) for light microscopy (Olympus BH2, Olympus Corporation, Tokyo, Japan). 11 Part of sam - ples were processed for and evaluated ... safety remains the main con - cern of any medical intervention of the pancreatic diseases. A previous preclinical in vivo study in swine demonstrated the feasibility and...
Ngày tải lên: 25/10/2012, 11:18
Báo cáo y học: "Clinical Management of Adult Patients with a History of Nonsteroidal Anti-Inflammatory Drug–Induced Urticaria/ Angioedema: Update" ppt
... presently very limited, including only nimesulide, paracetamol, and meloxicam. Third, the anti -inflammatory and/or analgesic activity of these remaining substances (nimesulide, paracetamol, meloxi- cam) ... Patients with NSAID-Induced Urticaria/Angioedema 29 ORIGINAL ARTICLE Clinical Management of Adult Patients with a History of Nonsteroidal Anti -Inflammatory Drug–Induced Urticar...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Altered expression of inflammatory cytokines in primary osteoarthritis by human T lymphotropic virus type I retrovirus infection: a cross-sectional study" pps
... M, Yoshida E, Takiguchi M, Sato K, Kitajima I, Nishioka K, Yamamoto K, Takeda T, Hatanaka M, Yamamoto H, Sekiguchi T: Induction of inflammatory arthropathy resembling rheumatoid arthritis in mice ... carriers and 55 non-carrier patients felt pain in the medial femorotibial joints, a common type in Japanese primary OA, whereas the remaining patients also complained of pain...
Ngày tải lên: 09/08/2014, 01:23
Tài liệu Báo cáo Y học: Differential response of neuronal cells to a fusion protein of ciliary neurotrophic factor/soluble CNTF-receptor and leukemia inhibitory factor pot
... C-terminal amino acids of CNTF-R (amino acids 331–346) that are not part of the membrane-proximal cytokine binding domain [33] and the 14 N-terminal nonhelical and presumably flexible amino acids of ... T., Hibi, M. , Yamanaka, Y. , Takahashi Tezuka, M. , Fujitani, Y. , Yamaguchi, T., Nakajima, K. & Hirano, T. (1996) Two signals are necessary for cell proliferation induced by...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo y học: "Stigmatising attitude of medical students towards a psychiatry label." pot
... Nigeria Email: Olawale O Ogunsemi* - waleogunsemi@yahoo.com; Olatunde Odusan - tunsan2001@yahoo.com; Michael O Olatawura - dareolatawura@yahoo.com * Corresponding author Abstract Background: The aim ... medical students towards a psychiatry label Olawale O Ogunsemi*, Olatunde Odusan and Michael O Olatawura Address: Olabisi Onabanjo University Teaching Hospital, Sagamu, Ogun State, Nigeria...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "The abilities of improved schizophrenia patients to work and live independently in the community: a 10-year long-term outcome study from Mumbai, India" ppsx
... community: a 10-year long-term outcome study from Mumbai, India Amresh Kumar Srivastava* 1,5 , Larry Stitt 2 , Meghana Thakar 1 , Nilesh Shah 3 and Gurusamy Chinnasamy 4 Address: 1 Mental Health ... Ontario, Canada Email: Amresh Kumar Srivastava* - amresh.edu@gmail.com; Larry Stitt - Larry.Stitt@schulich.uwo.ca; Meghana Thakar - meghana2711@yahoo.co.uk; Nilesh Shah - psysion@vsnl.com;...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "Regional assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis" pptx
... assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis Allan A Young 1 , Margaret M Smith 1 , Susan M Smith 1 , Martin A Cake 2 , Peter ... in place of authentic primary antibody. RNA extraction Approximately 100 mg of frozen cartilage samples was frag- mented in a Mikro-Dismembrator (Braun Biotech I...
Ngày tải lên: 09/08/2014, 06:23
Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx
... K, Kinsey SE, Markham AF, Emery P, McGonagle D: Enumeration and phenotypic characteriza- tion of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. ... MSC-induced immunosuppression may foster the growth of tumours, as exemplified in a murine melanoma model [4]. A platform model for cellular therapy research and applicat...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: "Extracellular localization of galectin-3 has a deleterious role in joint tissues" docx
... CAGTGTTGGCTGAGTGAAAGAGACCC 284 Osteocalcin S: CATGAGAGCCCTCACA AS: AGAGCGACACCCTAGAC 310 [48] Alkaline phosphatase S: TGCAGTACGAGCTGAACAG AS: TGAAGACGTGGGAATGGTC 267 Type I collagen α1 chain S: CCGAAGGTTCCCCTGGACGA AS: ... [39]. Osteocalcin determination The assay measured only intact human osteocalcin and was performed on human osteoblast-conditioned media using a specific enzyme immunoass...
Ngày tải lên: 09/08/2014, 10:20