0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "Angiogenic and angiostatic factors in systemic sclerosis: increased levels of vascular endothelial growth factor are a feature of the earliest disease stages and are associated with the absence of fingertip ulcers" doc

Báo cáo y học:

Báo cáo y học: "Angiogenic and angiostatic factors in systemic sclerosis: increased levels of vascular endothelial growth factor are a feature of the earliest disease stages and are associated with the absence of fingertip ulcers" doc

... systemic sclerosis: increased levels of vascular endothelial growth factor are a feature of the earliest disease stages and are associated with the absence of fingertip ulcersOliver Distler1, Angela ... decrease in angiogenic factors and/ or an increase in angiostatic factors, the potentproangiogenic molecules vascular endothelial growth factor (VEGF) and basic fibroblast growth factor, and the angiostatic factor ... increase of angio-static factors, another strategy for the treatment of ischemic symptoms in SSc is the inhibition of angiostatic factors rather than a further increase of VEGF. Angiostatic factors...
  • 10
  • 432
  • 0
Báo cáo y học:

Báo cáo y học: "Risk and resiliency factors in posttraumatic stress disorder" pptx

... self-report scales, one formeasuring state anxiety and another for measuring traitanxiety. For the purposes of the present study only the S-Anxiety scale was utilized. The S-Anxiety scale containstwenty ... thisstudy, being female, separation from parents in child-hood, and family and personal history of psychopatholo-gy were significant predictors of PTSD.Coping Factors Coping has been defined as the ... StatisticalManual-III Washington DC 1980, 2. American Psychiatric Association Diagnostic and StatisticalManual-III-R Washington DC 1987, 3. Everly GS Psychotraumatology In: Psychotraumatology: key papersand...
  • 9
  • 365
  • 0
Báo cáo Y học: Structural and compositional changes in very low density lipoprotein triacylglycerols during basal lipolysis potx

Báo cáo Y học: Structural and compositional changes in very low density lipoprotein triacylglycerols during basal lipolysis potx

... analysis of fatty acid composi-tion because of the uncertainty of the origin of each fattyacid.Previous work has reported that the polyunsaturated 20- and 22-acyl carbon fatty acids of human ... hydrolysis of triacylgly-cerol species with these fatty acids. It has been shownthat the hydrolysis of 20:4 containing triacylglycerol and diacylglycerol was slower in rat postheparin plasma ... [27]. The molecularassociations give the exact pairs of fatty acids in individualdiacylglycerol and the exact triplets of fatty acids in individual triacylglycerol.Statistics The values have...
  • 10
  • 412
  • 0
Báo cáo y học:

Báo cáo y học: "Tolerability and adverse events in clinical trials of celecoxib in osteoarthritis and rheumatoid arthritis: systematic review and meta-analysis of information from company clinical trial report" potx

... ideally effective, safe, and well tolerated.NSAIDs have provided the mainstay of pain therapy, particu-larly in the early stages of disease, but are often associated with clinically relevant adverse ... any pharmaceutical company.Authors' contributionsRAM was involved with planning the study, data extraction,analysis, and preparing the manuscript; SD with data extrac-tion, analysis, and ... writing; GTM with planning, data extraction,analysis, and writing the manuscript; HJM with planning, anal-ysis, and writing. All authors read and approved the finalmanuscript.Additional filesReferences1....
  • 22
  • 863
  • 0
Báo cáo y học:

Báo cáo y học: "Chondroitin and glucosamine sulfate in combination decrease the pro-resorptive properties of human osteoarthritis subchondral bone osteoblasts: a basic science study" pptx

... interpretation of data. HF and ML participated in acquisition of data. J-PP participated in analysis and interpretation of data and manuscript preparation.All authors read and approved the final manuscript.Acknowledgements The ... data, analysis and interpretation of data, manuscript preparation, and statisticalanalysis. JV and EM participated in study design. DL partici-pated in acquisition, analysis, and interpretation ... RNA was extracted and processed for quantitative polymerase chain reaction (qPCR), and the data are expressed as the mean ± standard error of the mean of arbitrary unit. The release of OPG was...
  • 10
  • 599
  • 1
Báo cáo y học:

Báo cáo y học: " Immunity and other defenses in pea aphids, Acyrthosiphon pisum" ppt

... 17LysozymesLysozymes represent a family of enzymes that degra debacterial cell walls by hydrolyzing the 1,4-beta-linkagesbetween N-acetyl-D-glucosamine and N-acetylmuramicacid in peptidoglycan ... signalingpathway leads to activation of components of the JNKsignaling pathway [11]. Specifically, when TAK, a pro-tein kinase of the IMD pathway, is activated, it triggers the JNK pathway. Whether ... hydro-lases, and their catalytic activities are similar. Indeed,some chitinases show lysozyme activity and vice versa[73]. In insects, chitinases are used to degrade the chitin in the exoskeleton and...
  • 17
  • 464
  • 0
Báo cáo y học:

Báo cáo y học: "Chronotypology and melatonin alterations in minimal hepatic encephalopathy" pot

... performed the statistical analysis, interpreted results and wrote the paper. All authors read and approved the final manu-script.AcknowledgementsWe thank the nursing and ancillary staff of the Internal ... absence of flapping tremor in all cirrhosis patients. These findingsdemonstrate minimal hepatic insufficiency, absence of biochemically active liver disease and absence of clinicalhepatic encephalopathy ... con-cerning usual habits, social and personal actions, and day-night behavior and calculates a score, thereby assigning a characteristic morning-evening type to each patient. Thisscore can result in...
  • 6
  • 366
  • 0
Báo cáo y học:

Báo cáo y học: "Bacterial and fungal microflora in surgically removed lung cancer samples." potx

... 421Legionella pneumophila AAGATTAGCCTGCGTCCGATTAG AACCCTCCTCCCCACTGAAAGT 232Borrelia burgdorferi CATGCAAGTCAAACGGGATGTA GACCTTCTTCATTCACGCAGTG 361americanavalaisianagariniirecurrentishispanicaduttoniilusitaniaespielmaniiListeria ... TGCCGTAGAGTGGGGGATAA CCGCAGGCTCATCGTAAAG 109aalborgiintemediaalvinipulliinnocenssuanatinaHaemophilus influenzae CTTGCTTTCTTGCTGACGAGTG TCTCAGTCCCGCACTTTCATC 129Candida I albicans CCAGCCGAGCCTTTCCTTCT ... 275denticola AGGGATATGGCAGCGTAGCAATA CGTCCTCCCTTACGGGTTAGACT 453vincentii GCGGTATGTAAGCCTGGTGTGAA TTTGCTTTGGCACTGAAGCTCTT 277Neisseria meningitidis AAGTCGGACGGCAGCACAGA TCAGCCGCTGATATTAGCAACAG 421Legionella...
  • 5
  • 389
  • 0
Báo cáo y học:

Báo cáo y học: "BioGlue and Peri-strips in lung volume reduction surgery: pilot randomised controlled trial" ppsx

... V Naidu, Prakash Nanjaiah, Mahmoud Loubani, Maninder S Kalkat and Pala B Rajesh*Address: Regional Department of Thoracic Surgery, Birmingham Heartlands Hospital, Bordesley Green East, Birmingham, ... hypercarbia. At the end of the proce-dure, the sternum was closed with sternal wires and the pre-sternal fascia and skin were closed in layers. The patients were all extubated at the end of the ... Birmingham, UKEmail: Sridhar Rathinam - srathinam@rcsed.ac.uk; Babu V Naidu - b_naidu@yahoo.com; Prakash Nanjaiah - drprks@yahoo.co .in; Mahmoud Loubani - mahmoud.loubani@ntlworld.com; Maninder S Kalkat...
  • 6
  • 351
  • 0
Báo cáo y học:

Báo cáo y học: " Foot and ankle surgery in Australia: a descriptive analysis of the Medicare Benefits Schedule database, 1997–2006" potx

... surgery in Australia is heavily subsidisedby Medicare, a universal healthcare system financedthrough income tax and an income-related Medicare levy.Governed by the Australian Health Care Agreementsbetween ... ana-lysed and interpreted the data, and drafted the manu-script. MFG and KBL assisted with data interpretation. Allauthors read and approved the final version of the manu-script.Additional materialAcknowledgementsHBM ... Gilheany - mgpod@alphalink.com.au; Karl B Landorf - k.landorf@latrobe.edu.au* Corresponding author AbstractBackground: Foot and ankle problems are highly prevalent in the general community and...
  • 10
  • 369
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ