Báo cáo khoa học: "Pancreatic adenocarcinoma in a patient with Situs Inversus: a case report of this rare coincidence" pot

... Central Page 1 of 4 (page number not for citation purposes) World Journal of Surgical Oncology Open Access Case report Pancreatic adenocarcinoma in a patient with Situs Inversus: a case report of ... are at increased risk of malignancy. Since that time there have been no new reported cases of pancreaticoduodenectomy in SI patients. We present a case of...

Ngày tải lên: 09/08/2014, 04:21

... tests and all provided written informed consent for participation in this study. After having the diagnosis of neoplasia confirmed by the anatomopathological examination, and being indicated this ... treatment hearing loss etiology may have had a clinical diagnosis of presbycusis because of the age of the patients. Patients that had known causes of hearing loss were excluded...

Ngày tải lên: 09/08/2014, 10:20

... puberty in a boy with HcG-producing hepatoma. Case report. Helv Paediatr Acta 1980, 35(2):155-163. 11. Morinaga S, Yamaguchi M, Watanabe I, Kasai M, Ojima M, Sasano N: An immunohistochemical study of ... 5:422 http://www.jmedicalcasereports.com/content/5/1/422 Page 2 of 4 CASE REP O R T Open Access Precocious puberty in an infant with hepatoblastoma: a case report Usa...

Ngày tải lên: 10/08/2014, 23:20

... automatically apply a partial parsing that allows us to deal with other kinds of anaphors as well as pronouns. In this work we are going to apply a partial parsing on the output of a POS tagger in order ... of anaphora are pronominal references, surface- count anaphora and one-anaphora. In order to solve these anaphors we work on the output of a part -of- speec...

Ngày tải lên: 08/03/2014, 05:21

Ngày tải lên: 09/03/2014, 01:20

... used as a template to amplify 100-bp cDNA TMV with primers TMV3 (upstream) 5¢-TA ATACGACTCACTATAGGGCGAATAGGCGGGAATT TTGCATC-3¢ containing the T7 polymerase promoter sequence, and TMV4 (downstream) ... 5¢-end of the TMV genome within the replicase-coding sequence (ORF 1) was an additional advantage. The designed catalytic strand of the leadzyme was a 16-nucleotide RNA (5¢-ACAUAUGGAGU...

Ngày tải lên: 16/03/2014, 12:20

... training and 10% testing sets for 5-cross validation. MOCHA and TORGO data are never combined in a single training set due to dif- fering EMA recording rates. In all cases, models are database-dependent ... ms in the TORGO database, and 32 ms in MOCHA. Phoneme boundaries are de- termined automatically in the MOCHA database by forced alignment, and by a speech-language pathologis...

Ngày tải lên: 16/03/2014, 23:20

... the grammar. Each feature has a name (a string of uppercase alphanumeric characters) and an associated value. The values a feature can take on (the domain of the feature) are, in general, arbitrary. ... powerful and compact for-alism for representing a language, similar to the earlier ATN formalisms [1]. An example of how an APSG can encode a large subset of English i...

Ngày tải lên: 24/03/2014, 01:21

... are part of a genuine text-based parsing formalism incorporating a llnguistical level in terms of a distributed text grammar and a computational level in terms of a corresponding text parser ... condition have to be bound in order to work out a truth value. In App .A and App.B underlining of variables indicates that they have already been bound, i.e. the eva...

Ngày tải lên: 31/03/2014, 17:20

... between individuals and a nuclear family are updated taking advantage of the conditional independence of the offspring given their parents. The summations are done for all the individuals in the ... equivalent to determining an optimal order of elimination in sparse system of linear equations. Thus algorithms that have been developed to determine the order of elimination in...

Ngày tải lên: 09/08/2014, 18:21