Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc
Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf
... strains. The G1 rotavirus VP7 gene specific primers were described by Das et al. [2] and Gouvea et al. [6]. Mismatches are in red. TCTTGTCAAAGCAAATAATA 3’ 5’ Das primer, 9T1-1 CAAGTACTCAAATCAATGATGG 5’ 3’ Gouvea ... 9T1-1 CAAGTACTCAAATCAATGATGG 5’ 3’ Gouvea primer, aBT1 Target sequence Target sequence CAAGTACTCAAATCAGTGATGG TTTAGTTAAGGCAAATAATA BioMed Central Page 1 of 5 (page number...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pptx
... Das et al. [2] and Gouvea et al. [6]. Mismatches are in red. TCTTGTCAAAGCAAATAATA 3’ 5’ Das primer, 9T1-1 CAAGTACTCAAATCAATGATGG 5’ 3’ Gouvea primer, aBT1 Target sequence Target sequence CAAGTACTCAAATCAGTGATGG TTTAGTTAAGGCAAATAATA ... Breiman 1 , David A Sack 1 , Marc Van Ranst 2 and Tasnim Azim 1 Address: 1 ICDDR,B: Centre for Health and Population Research, Mohakhali, Dhaka-1212, Ba...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc
... is of Mexican origin. The index case was a 23-year-old female diagnosed with breast carci- noma of the left breast with combined histological fea- tures of lobular carcinoma and infiltrating ... Journal of Surgical Oncology Open Access Research Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni s...
Ngày tải lên: 09/08/2014, 04:21
Báo cáo khoa học: " Identification of a putative cellular receptor 150 kDa polypeptide for porcine epidemic diarrhea virus in porcine enterocytes" pps
... (Suwon, Korea) for manufacturing PEDV live vaccine by the National Veterinary Research and Quarantine Service (Anyang, Korea). KPEDV-9 was propagated in Vero cells with virus replication medium ... protein binding assay (VOPBA) was used to identify PEDV binding protein in permissive cells. The binding ability of PEDV to porcine APN (pAPN) and the effects of pAPN on infectivity...
Ngày tải lên: 07/08/2014, 17:22
báo cáo khoa học: " Identification of novel maize miRNAs by measuring the precision of precursor processing" ppsx
... 21 AAAUUAUAGGGCAUUUUUAUA 0 0 0.68 0.52 family3 3 miRNA37 20 GUUAUUUUCGGUAGCAUAAG 0 0 0.41 0.1 family3 4 miRNA38 21 AAAAAGAAACGGAGGGAGUAC 1.32 0.58 0.07 2.82 family3 5 miRNA39 21 AUACUAGGAGUGAAGGGAUCA ... miRNA56 21 UUUGGGAGCAAGUGGAAUGGA 0.15 0 0 0.52 family5 3 miRNA57 20 GAGACAAUUGCAUAUUUAGG 0 0.42 0.41 0.42 family5 4 miRNA58 20 GAAGAGGAACACAAACAGAG 0 0.5 0 0 family5 5 miRNA59 21 UAAGAC...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx
... gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataa tttgag G K Q V K M M L E K Q L K S N Q K 721 ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat 781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ... tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaa Figure 3 Full-length cDNA and dedu...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Identification of drought-response genes and a study of their expression during sucrose accumulation and water deficit in sugarcane culms" potx
... resulting in an approximately seven- fold increase in the total amino acid content. The expression of the AS gene, encoding a transaminase responsible for the synthesis of asparagine from aspar- tate ... Hanzawa Y, Akiyama T, Tamaoki M, Saji H, Shirano Y, Kato T, Hayashi H, Shibata D, Tabata S, Komeda Y, Takahashi T: Spermidine synthase genes are essential for survival of...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: "Identification of improved IL28B SNPs and haplotypes for prediction of drug response in treatment of hepatitis C using massively parallel sequencing in a cross-sectional European cohor" pot
... total). Validation with original GWAS SNP data and HapMap data CRISP called all 15 of the SNPs individually typed as part of the GWAS as variants. The Spearman correla- tion coefficients of MAF e stimates ... 41:1100-1104. 4. Tanaka Y, Nishida N, Sugiyama M, Kurosaki M, Matsuura K, Sakamoto N, Nakagawa M, Korenaga M, Hino K, Hige S, Ito Y, Mita E, Tanaka E, Mochida S, Murawaki Y...
Ngày tải lên: 11/08/2014, 12:21
Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"
... physicians had to order a 'vancomycin loading dose' and a 'vancomycin dose accord- ing to plasma level', without having to adjust anything, which virtually eliminates the risk of ... designing the study. KC was responsible for conceiving the study, data acquisition, analysis of the data, statistical analysis and drafting of the manuscript. BC was respon...
Ngày tải lên: 25/10/2012, 10:39
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx
... parameter optimization. The half-height widths of the NMR signals were used as a measure of the uncertainty of each NMR data point and an experimental uncertainty of 2% was assumed for the experimental points ... sulfate-reducing bacteria are small soluble proteins containing four haems, and have been assigned a fundamental role in the bioenergetic metabolism of thes...
Ngày tải lên: 19/02/2014, 17:20