Báo cáo khoa học: "Three synchronous primary carcinomas in a patient with HNPCC associated with a novel germline mutation in MLH1: Case report" docx

Báo cáo khoa học: "Three synchronous primary carcinomas in a patient with HNPCC associated with a novel germline mutation in MLH1: Case report" docx

Báo cáo khoa học: "Three synchronous primary carcinomas in a patient with HNPCC associated with a novel germline mutation in MLH1: Case report" docx

... report Three synchronous primary carcinomas in a patient with HNPCC associated with a novel germline mutation in MLH1: Case report Cristian D Valenzuela 1 , Harvey G Moore* 1 , William C Huang 2 , Elsa ... characterized by three synchronous primary carcinomas: ascending and splenic flexure colon adenocarcinomas, and ureteral carcinoma. Ureteral neoplasm...

Ngày tải lên: 09/08/2014, 04:21

6 480 0
Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf

Báo cáo khoa học: Cellular refractoriness to the heat-stable enterotoxin peptide is associated with alterations in levels of the differentially glycosylated forms of guanylyl cyclase C pdf

... present in the protein kinase-like domain in the basal state [2]. Mutation of any of these sites to alanine led to a decrease in ANP-mediated activation and simultaneous mutations in all the ... 10 min at 37 °Cwith 4m M MgCl 2 and 1 m M GTP as substrate. Receptor binding analysis ST Y72F was iodinated using Na 125 I as described earlier [30] and was available in the laboratory....

Ngày tải lên: 08/03/2014, 08:20

10 427 0
Báo cáo khoa học: "Advantage of vacuum assisted closure on healing of wound associated with omentoplasty after abdominoperineal excision: a case report" pdf

Báo cáo khoa học: "Advantage of vacuum assisted closure on healing of wound associated with omentoplasty after abdominoperineal excision: a case report" pdf

... omentum in APR with excellent primary perineal wound healing[6]. According to Christian study's patients with anal cancer and inflammatory bowel disease were at higher risk for perineal wound ... T3 local invasion and invaded nodes as well as septic con- tamination. Case 2 A 51-year-old man, with AIDS, previously treated for Hodgkin's disease, developed a local recur...

Ngày tải lên: 09/08/2014, 07:22

5 310 1
báo cáo khoa học: "Renal and suprarenal insufficiency secondary to familial Mediterranean fever associated with amyloidosis: a case report" potx

báo cáo khoa học: "Renal and suprarenal insufficiency secondary to familial Mediterranean fever associated with amyloidosis: a case report" potx

... observed during early childhood in the vast majority of patients with FMF and is associated with symptoms such as fever, abdominal pain, and inflammation attacks. Those patients are grouped as phenotype ... regularly except col- chicine tablets. At his physical examination, his general appearance was apathic and cachectic, his mucous membranes were dry and pale, and his skin was dry a...

Ngày tải lên: 10/08/2014, 23:20

3 387 0
báo cáo khoa học: " Timing is everything: early degradation of abscission layer is associated with increased seed shattering in U.S. weedy rice" doc

báo cáo khoa học: " Timing is everything: early degradation of abscission layer is associated with increased seed shattering in U.S. weedy rice" doc

... layer may be delayed and incomplete. Our overall observations of clear abscission layers upon flowering in shattering wild Oryza individuals and lack of abscission layers at this stage in non-shattering cultivated ... at flowering. The lack of an abscission layer at flowering in all three indica cultivated accessions is consistent with their lack of shattering (average BTS = 70 to 137...

Ngày tải lên: 11/08/2014, 11:21

10 257 0
Tài liệu Báo cáo khoa học: Three-dimensional structures of thermophilic b-1,4-xylanases from Chaetomium thermophilum and Nonomuraea flexuosa Comparison of twelve xylanases in relation to their thermal stability pdf

Tài liệu Báo cáo khoa học: Three-dimensional structures of thermophilic b-1,4-xylanases from Chaetomium thermophilum and Nonomuraea flexuosa Comparison of twelve xylanases in relation to their thermal stability pdf

... Finland. E-mail: Nina.Hakulinen@joensuu.fi Abbreviations:AKX,Aspergillus kawachii xylanase; ANX, Aspergillus niger xylanase; BAX, Bacillus agaradhaerens xylanase; BCX, Bacillus circulans xylanase; ... containing 235 amino acids and N. flexuosa as a construct coding mainly the catalytic domain (220 amino acids). However, it is likely that an extracellular protease has cleaved off the C-termina...

Ngày tải lên: 20/02/2014, 23:20

14 520 0
Tài liệu Báo cáo khoa học: "Three BioNLP Tools Powered by a Biological Lexicon" doc

Tài liệu Báo cáo khoa học: "Three BioNLP Tools Powered by a Biological Lexicon" doc

... Simonetta Montemagni, Monica Monachini, Nicoletta Calzolari, Sophia Ananiadou, BioLexicon: Towards a Reference Terminological Resource in the Biomedical Domain, the 16th Annual International Conference ... …” IL/NP IL-2/NN-BIOMED -/- 2/CD mediated/VVD IL-2-mediated/UNKNOWN IL/NP 2/CD IL-2/NN-BIOMED BioLexicon mediated/VVD mediate/VVP mediate/VV of /IN mediated/VVN -/- -/- m...

Ngày tải lên: 22/02/2014, 02:20

4 334 0
Báo cáo khoa học: "Bayesian Synchronous Tree-Substitution Grammar Induction and its Application to Sentence Compression" pdf

Báo cáo khoa học: "Bayesian Synchronous Tree-Substitution Grammar Induction and its Application to Sentence Compression" pdf

... USA. As- sociation for Computational Linguistics. Dan Klein and Christopher D. Manning. 2003. Fast exact inference with a factored model for natural language parsing. In Advances in Neural Informa- tion ... maximization and variational Bayes training, illustrating the merits of nonparametric inference over the space of grammars as opposed to sparse parametric inference with a fixed...

Ngày tải lên: 07/03/2014, 22:20

11 424 0
Báo cáo khoa học: Three-step hydroxylation of vitamin D3 by a genetically engineered CYP105A1 doc

Báo cáo khoa học: Three-step hydroxylation of vitamin D3 by a genetically engineered CYP105A1 doc

... Kurokawa, Imizu, Toyama, Japan Fax: +81 766 56 2498 Tel: +81 766 56 7500 E-mail: tsakaki@pu-toyama.ac.jp Database Structural data are available in the Protein Data Bank database under the accession numbers ... Miyazaki A, Saito M, Adachi T, Mizoue K, Hanada K & Omura S (1992) Transformation of vita- min D3 to 1 alpha,25-dihydroxyvitamin D3 via 25-hydroxyvitamin D3 using Amycolata sp. s...

Ngày tải lên: 15/03/2014, 23:20

11 505 0
Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt

Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt

... CGGGACGGTGTTGAGAGTGGA CXCL12.rv5 GAGAGTGGACCGGCACCAACA qCXCL12b.fw1 GAGGAGGACCACCATGCATCT qCXCL12b.rv1 TTGTGCAAGCAGTCCAGAAAGA Carp CXCL14 AJ536028 CXCL14.rv3 GGATGCAGGCAATACTCCTG CXCL14.fw5 CCATACTGCCAAGAAAAGATGAT qCXCL14.fw1 ... CAACAGGGAAAAGATGACACAGATC qACT.rv1 GGGACAGCACAGCCTGGAT Vector T7 TAATACGACTCACTATAGGG T3 CGCAATTAACCCTCACTAAAG Ó FEBS 2004 Three novel carp CXC chemokines (Eur. J....

Ngày tải lên: 16/03/2014, 18:20

13 398 0
w