Báo cáo khoa học: "Urachal tumour: case report of a poorly understood carcinoma" pot

... VE, Olgac S: Urachal carcinoma: a clinicopathologic analysis of 24 cases with outcome correlation. Am J Surg Pathol 2009, 33(5):659-68. 4. Ghazizadeh M, Yamamoto S, Kurokawa K: Clinical features of urachal ... CF are radi- ologists of the Department of Radiology. All authors read and approved the final manuscript. References 1. Sheldon CA, Clayman RV, Gonzalez R, Williams RD, Fraley...

Ngày tải lên: 09/08/2014, 04:21

... the most affected area of these metastases. Case presentation: We present a case of a 76 year old Woman with multiple giant scalp metastases of a follicular carcinoma. These metastases had been ... TR, Duncan LM, Zembowicz A, Faquin WC: Cutaneous metastases of follicular thyroid carcinoma: a report of four cases and a review of the literature. Am J Dermatopathol 2...

Ngày tải lên: 09/08/2014, 07:21

... porocarcinoma: report of a case and review of the literature Ugo Marone 1* , Corrado Caracò 1 , Anna Maria Anniciello 2 , Gianluca Di Monta 1 , Maria Grazia Chiofalo 1 , Maria Luisa Di Cecilia 1 , ... eccrine carcinoma. A case combining features of eccrine poroma and Paget’s dermatosis. Arch Dermatol 1963, 88:597-607. 4. Mehregan AH, Hashimoto K, Rahbari H: Eccrine adenocarcin...

Ngày tải lên: 09/08/2014, 01:24

... was obtained from the patient for publication of this case report and any accompany- ing images. Author details 1 Department of Pathology, Tata Memorial Hospital, Parel, Mumbai. 2 Department of ... a tufted hemangioma [11]. A similar co- existence of lymphangiectasia with vascular tumor nodules is seen in a tufted angioma. KHE and tufted angioma are probably same part of t...

Ngày tải lên: 09/08/2014, 01:24

... herein report a case of a patients with a giant GIST of the duodenum. After neoadjuvant imatinib therapy was initiated, a dramatic tumor regression led to an upper gastrointestinal bleeding and an ... high safety of imatinib can be transferred to patients with GISTs at rare tumor localiza- tions. Alternatively primary surgery should be seen as an alternative therapeutic appr...

Ngày tải lên: 09/08/2014, 03:21

... clinical and radiological data. FRF and PKB analyzed and interpreted the pathological data. TF and FRF wrote the main parts of the manuscript. All authors read and approved the final manuscript. Competing ... composite paraganglioma with neuroblastoma in a man: a case report. Journal of Medical Case Reports 2010 4:3 74. Submit your next manuscript to BioMed Central and take full...

Ngày tải lên: 11/08/2014, 02:22

... the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from InsP 6 using a modified ferrous sulfate ... higher specific activity k cat and V max values and lower K m value of PhyH suggests that PhyH is more catalytically efficient and has a greater affinity for InsP 6 than PhyH-DII. Substrate s...

Ngày tải lên: 14/02/2014, 15:20

... molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamoyl -a- amino acid. ... expression of DCase [31], which confers more application advantages to HYD Js as a single set of chaperones can assist soluble expression of both HYD Js and DCase. Although almo...

Ngày tải lên: 18/02/2014, 08:20

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the C-terminus ... addition to an N-terminal Nco1 cloning site. The forward o ligomer 5 ¢-TCCGAAACCAGCG GCCGCTT TATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and the reverse oligomer 5¢-GTAGGCCTT TGAA...

Ngày tải lên: 19/02/2014, 06:20

... senses across dictionaries, hence Wik is only used as augmented data for WMF to better learn the semantics of words. All data is tokenized, POS tagged (Toutanova et al., 2003) and lemmatized, ... this case, many senses will share the same latent semantics profile, as long as they are in the same topic/domain. To solve the sparsity issue we use missing words as negative evidence of latent...

Ngày tải lên: 19/02/2014, 19:20