Báo cáo khoa học: "Clinical experience of novel interconnected porous hydroxyapatite ceramics for the revision of tumor prosthesis: a case report" pdf

... Access Case report Clinical experience of novel interconnected porous hydroxyapatite ceramics for the revision of tumor prosthesis: a case report Yukihiro Yoshida* 1 , Shunzo Osaka 2 and Yasuaki ... Subsequently, postoperative chemotherapy was performed for about 6 months. On May 2007, about 11 years after the operation, she noticed pain in the left thig...

Ngày tải lên: 09/08/2014, 04:21

... nuclear pre-mRNA and to catalyze the accurate removal of introns and ligation of exons to yield a mature mRNA. The affinity of the splicing complexes to RNA was used in this approach for the isolation of the ... with associated proteins from mouse brain preparations. The large-scale approach: tandem affinity purification While the aforementioned techniques all have part...

Ngày tải lên: 31/03/2014, 07:20

... this case. Conclusion We report a rare case of low-grade B-cell lymphoma with abundant intracellular Ig accumulation. The patient’s clinical presentation and MRI suggested a soft- tissue tumor, and ... ultra- structural and molecular studies. It is important for pathologists to be aware of this rare extranodal Ig-rich lymphoma because of the potential for confusion with...

Ngày tải lên: 11/08/2014, 00:22

Ngày tải lên: 11/08/2014, 02:22

... co- immunoprecitation assays to analyze the association of FADD and caspase-8 in HeLa cells after radiation treatment. As shown in Fig. 1C, interaction between FADD and caspase-8 was increased in cells treated M ... precedes radi- ation-induced apoptotic conformational changes in Bax and Bak, we performed western blot analysis to analyze Bid cleavage after irradiation. Exposure of HeLa...

Ngày tải lên: 07/03/2014, 05:20

... does it take for a given active state to match a given span? For TRIE and LIST, an active state cor- responds to a prefix of a rule and is a mix of POS tags and phrasal categories, each of which ... frequently speak in terms of the following: span: a range of words in the chart, e.g., [1,3] 4 edge: a category over a span, e.g., NP:[1,3] traversal: a way of...

Ngày tải lên: 17/03/2014, 07:20

... reverse primers: CCAT CCATGGCTAGGAAGCAAGGGACAGC TCTCC, GGAT CCATGGTCATGGAAACATATCCATA AATCGG and CCAT CCATGGTCAGTTGATAGGAGC TGTGAAGAAAAC, respectively (all incorporating NcoI site, underlined). The resulting ... plasmid encoding TAP-tag only was gener- ated similarly to pchSUV3-650–786-TAP with the exception that the forward primer had the following sequence: CGT CTCGAGATGGAAA AGAGAAG...

Ngày tải lên: 23/03/2014, 15:21

...

Ngày tải lên: 07/08/2014, 18:21

... Suga K, Ogasawara N, Yuan Y, Okada M, Matsunaga N, Tangoku A: Visualization of breast lymphatic pathways with an indirect computed tomography lymphography using a nonionic mon- ometric contrast ... took part in the care of patients and helped in preparation of the manuscript. All authors read and approved the manu- script. References 1. Veronesi U, Paganelli G, Viale G, Luini...

Ngày tải lên: 09/08/2014, 07:21

... L1273–L1281. 18 Nakamura YS, Hakeda Y, Takakura N, Kameda T, Hamaguchi I, Miyamoto T, Kakudo S, Nakano T, Kumegawa M & Suda T (1998) Tyro 3 receptor tyro- sine kinase and its ligand, Gas6, stimulate the ... in the deg- radation of clotting factors Va and VIIIa [5]. Gas6 has the same domain organization as protein S, namely an N-terminal region containing 11 c-carboxyglutamic acid...

Ngày tải lên: 19/02/2014, 05:20