Báo cáo khoa học: "Esophagopericardial fistula as a rare complication after total gastrectomy for cancer" pdf

... report Esophagopericardial fistula as a rare complication after total gastrectomy for cancer Nikolaos Dafnios, Georgios Anastasopoulos, Athanasios Marinis*, Andreas Polydorou, Georgios Gkiokas, Georgios ... of an EPF as a rare complication after total gastrectomy for gastric cancer. The prognosis of EPF is poor, especially when it is associated with malignan...

Ngày tải lên: 09/08/2014, 04:21

... S, Asano N & Suzuki Y (1999) Acceler- ated transport and maturation of lysosomal alpha-galac- tosidase A in Fabry lymphoblasts by an enzyme inhibitor. Nat Med 5, 112–115. 20 Fan J-Q & ... Natl Acad Sci USA 103, 13813–13818. 29 Yu L, Ikeda K, Kato A, Adachi I, Godin G, Compain P, Martin O & Asano N (2006) alpha-1-C-octyl-1-de- oxynojirimycin as a pharmacological chaperone f...

Ngày tải lên: 18/02/2014, 16:20

... the association of the variable heavy chain (V H )with protein A was used as a surrogate for direct stability measurements. The V H domains in camelid heavy chain antibodies are most similar to ... stabilities. Remarkably, we have found that, at least in some circumstances, a quanti- tative correlation to biophysical data can be obtained from a statistical analysis of selected pha...

Ngày tải lên: 19/02/2014, 12:20

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk. The resulting ... (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTC...

Ngày tải lên: 19/02/2014, 17:20

... without being changed by the action. Atoms are printed in boldface iff they contradict the goal. This plan can be read as a derivation tree that has one node for each action instance in the plan, and an edge ... planning specification language and show how LTAG grammaticality can be encoded as a PDDL problem and how we can reconstruct an LTAG derivation from the plan. 2.1 Tree-adjoin...

Ngày tải lên: 20/02/2014, 12:20

... discriminant analysis (LDA).Thisstatistical multivariate method is supervised. It searches for the variables containing the greatest interclass variance and the smallest intraclass variance, and constructs ... Many parameters can be adjusted for increasing the efficiency of the algorithm. The data were analysed with a window of five wavenumbers, assuming that adjacent wavenumbers are high...

Ngày tải lên: 21/02/2014, 03:20

... Klimas ˇ auskas for M.HhaI, A. S. Bhagwat for plasmid pT71 used for construction of a hybrid plasmid carrying the gene for M.EcoRII and O. V. Kirsanova for help on purification of M.EcoRII. We are ... be that the 4-NH 2 group of the target cytosine is not essential for recognition of DNA by M.EcoRII as was suggested for several other MTases, as base flipping probably occurs...

Ngày tải lên: 07/03/2014, 15:20

... h; Asp255His, 4.5 h; Pro136Leu, 8 h). After the chase ASA was immunoprecipitated from the homogenates with the polyclonal ASA antiserum. Precipi- tated ASA was quantified after SDS ⁄ PAGE with a ... low amounts of Kif stabilized ASA appear in the medium. The same experiment was performed with all ER retained ASAs, all showed identical results. P. Poeppel et al. Arylsulfatase A degradat...

Ngày tải lên: 07/03/2014, 17:20

... any information associated with a name, for instance, an activity value, is viewable from any spaces in which the name exists. This means that any interpreted meaning associated with a name ... grammar can be affected in isolation from other aspects of language function. (Cf Studies of agrammatic and Broca's aphasia as described in Goodenough, Zurif, and Weintraub, 1977; G...

Ngày tải lên: 08/03/2014, 18:20

... 20 years of research. Psy- chological Bulletin, 124:372–422. Brian Roark, Asaf Bachrach, Carlos Cardenas, and Christophe Pallier. 2009. Deriving lexical and syn- tactic expectation-based measures ... the ability of lexicalized surprisal to explain a significant amount of variance in RT data for naturalistic texts, over and above that accounted for by other low-level lexical factors, such...

Ngày tải lên: 08/03/2014, 21:20