Báo cáo khoa học: "Esophagopericardial fistula as a rare complication after total gastrectomy for cancer" pdf
Báo cáo khoa học: "Esophagopericardial fistula as a rare complication after total gastrectomy for cancer" pdf
... report
Esophagopericardial fistula as a rare complication after total
gastrectomy for cancer
Nikolaos Dafnios, Georgios Anastasopoulos, Athanasios Marinis*,
Andreas Polydorou, Georgios Gkiokas, Georgios ... of an EPF
as a rare complication after total gastrectomy for gastric
cancer. The prognosis of EPF is poor, especially when it is
associated with malignan...
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt
... S, Asano N & Suzuki Y (1999) Acceler-
ated transport and maturation of lysosomal alpha-galac-
tosidase A in Fabry lymphoblasts by an enzyme
inhibitor. Nat Med 5, 112–115.
20 Fan J-Q & ... Natl Acad Sci USA 103, 13813–13818.
29 Yu L, Ikeda K, Kato A, Adachi I, Godin G, Compain
P, Martin O & Asano N (2006) alpha-1-C-octyl-1-de-
oxynojirimycin as a pharmacological chaperone f...
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx
... the association of the variable heavy chain (V
H
)with
protein A was used as a surrogate for direct stability
measurements. The V
H
domains in camelid heavy chain
antibodies are most similar to ... stabilities. Remarkably, we
have found that, at least in some circumstances, a quanti-
tative correlation to biophysical data can be obtained from
a statistical analysis of selected pha...
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) for amplification of pyk. The resulting ... (5¢-GG
AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and
downstream to pyk using primer pyk3 (5¢-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4
(5¢-CTAGTC...
Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx
... without
being changed by the action. Atoms are printed in
boldface iff they contradict the goal.
This plan can be read as a derivation tree that has
one node for each action instance in the plan, and an
edge ... planning specification language and
show how LTAG grammaticality can be encoded as
a PDDL problem and how we can reconstruct an
LTAG derivation from the plan.
2.1 Tree-adjoin...
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... discriminant analysis (LDA).Thisstatistical
multivariate method is supervised. It searches for the
variables containing the greatest interclass variance and
the smallest intraclass variance, and constructs ... Many
parameters can be adjusted for increasing the efficiency of
the algorithm. The data were analysed with a window of five
wavenumbers, assuming that adjacent wavenumbers are
high...
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx
... Klimas
ˇ
auskas for M.HhaI, A. S. Bhagwat for
plasmid pT71 used for construction of a hybrid plasmid carrying the
gene for M.EcoRII and O. V. Kirsanova for help on purification of
M.EcoRII. We are ... be that the 4-NH
2
group of the target
cytosine is not essential for recognition of DNA by
M.EcoRII as was suggested for several other MTases, as
base flipping probably occurs...
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx
... h; Asp255His, 4.5 h;
Pro136Leu, 8 h). After the chase ASA was
immunoprecipitated from the homogenates
with the polyclonal ASA antiserum. Precipi-
tated ASA was quantified after SDS ⁄ PAGE
with a ... low amounts of Kif stabilized ASA appear in the medium.
The same experiment was performed with all ER retained ASAs, all
showed identical results.
P. Poeppel et al. Arylsulfatase A degradat...
Báo cáo khoa học: "GAMR VIEWED AS A FUNCTIONING PART OF A COGNITIVES SERM A YTM" pot
... any information associated with a
name, for instance, an activity value, is viewable
from any spaces in which the name exists. This
means that any interpreted meaning associated with
a name ... grammar can be affected in
isolation from other aspects of language function.
(Cf Studies of agrammatic and Broca's aphasia as
described in Goodenough, Zurif, and Weintraub,
1977; G...
Báo cáo khoa học: "Lexical surprisal as a general predictor of reading time" potx
... 20 years of research. Psy-
chological Bulletin, 124:372–422.
Brian Roark, Asaf Bachrach, Carlos Cardenas, and
Christophe Pallier. 2009. Deriving lexical and syn-
tactic expectation-based measures ... the ability of lexicalized surprisal to
explain a significant amount of variance in RT
data for naturalistic texts, over and above that
accounted for by other low-level lexical factors,
such...
Từ khóa: