Báo cáo khoa học: "Curative resection of a primarily unresectable acinar cell carcinoma of the pancreas after chemotherapy" docx
... was taken from the pancreatic head, and the oper- ation was completed as an explorative laparotomy. Again, the diagnosis of an ACC was reconfirmed by histopathol- ogy. After implantation of a ... of 6 (page number not for citation purposes) World Journal of Surgical Oncology Open Access Case report Curative resection of a primarily unresectable acinar cell car...
Ngày tải lên: 09/08/2014, 04:21
... and Bachelard, 1993); and ii) the variations of the respective proportions of Ca2+ , Mg2+ and Al were not taken into account. What- Tanaka A, Tadano T, Yamamoto K, Kanamura N ... chromatographic peak. The be- haviour of outersphere organic complexes of Al and the Al-PO 4 and Al-Si monomers along the chromatographic pathways re- mains unkn...
Ngày tải lên: 08/08/2014, 19:21
... mgÆL )1 culture. DNA-bisintercalation activity assay Oligonucleotides AS1 5¢-AATATACGTTCGATTAA-3¢ and AS2 3¢-TTATATGCAAGCTAATT-5¢ were synthe- sized by Operon on a 50 nm scale. Annealing of each 5¢-oli- gonucleotide ... isolation, characteriza- tion and antitumor activity. J Antibiot 33, 1087–1097. 25 Okada H, Suzuki H, Yoshinari T, Arakawa H, Okura A, Suda H, Yamada A & Uemura D (...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo khoa học: "Evapotranspiration measurements in a Mediterranean forest stand by means of ecophysiological and microclimatic techniques" ppsx
... central and southern Italy during the summer period, makes the analysis of the water cycle in forest and its impact on watershed management impor- tant. The techniques available ... A plastic tank was attached around the stem and filled with water. The bark and the first xylem rings were cut in the water in order to allow water up...
Ngày tải lên: 09/08/2014, 02:21
báo cáo khoa học: "Extensive central nervous system involvement in Merkel cell carcinoma: a case report and review of the literature" docx
... the f irst report in the literature of intracranial metastasis of MCC that was treated with gamma knife, although the primar y indicatio n at the t ime of gamma knife surgery was removal of a ... despite treating the intracranial metastasis with gamma knife and the abdominal metastases with surgical dissection and external radiotherapy. This indicates the aggressive na...
Ngày tải lên: 11/08/2014, 03:20
báo cáo khoa học: " Habituation to thaxtomin A in hybrid poplar cell suspensions provides enhanced and durable resistance to inhibitors of cellulose synthesis" potx
... microarray data (CEL file) from IXBhab cells available at GEO (GSE6181) or NASC (NASCARRAYS-27) were analyzed using RMA and SAM with the Flexarray soft- ware. Genes that displayed a change of expression ... polygalacturonase, a pectinesterase, two expansins and a lyase. Expression data in TA(-)hab cells was compared to that of Arabidopsis IXBhab cells [32] using matching AGIs (Add...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Recruitment activities for a nationwide, population-based, group-randomized trial: the VA MI-Plus study" pps
... of this project. Author details 1 VA Research Enhancement Award Program (REAP), Birmingham VA Medical Center, Birmingham, AL, USA. 2 Department of Medicine, University of Alabama at Birmingham ... list of all eligible clinicians and their em ail addresses were obtained. The date these materials were approved and posted was the facility’s launch date. Figure 2 Facility participatio...
Ngày tải lên: 10/08/2014, 11:20
báo cáo khoa học: "DOF-binding sites additively contribute to guard cell-specificity of AtMYB60 promoter" potx
... AGTTAATGGcgcgaGCAGAGTGACTCGTGA mp60DOF2F1 TGGCAGATCCcgcgaAGGTTGTCAAGAAAA mp60DOF3F2 TGTCAAGAcgcgaCAGATTTAAAAGTTCTT mp60DOF4F2 CAAGAAAAAGCAGATTTcgcgaTTCTTC mp60WRKYF1 AAGCTTCGTGTGGAGATCAACATATCTTCGTTAATTGAaTACGCAAAATA ... AAGCTTTAACGAGCTCCTTTTATGG p60F9 AAGCTTCCATTTATGAGTTGATTATCA p60F3 AAGCTTCGTGTGGAGATCAACAT p60F5 AAGCTTGCAGAGTGACTCGTGA p60R5 TCTCGGATCCTCTAGATCTCTCTG p60R6 TC...
Ngày tải lên: 11/08/2014, 11:21
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: neurovascular injury and angiogenic recovery after stroke docx
... humans. Taken together, the accumulating experimental and clinical data suggest that MMPs (and perhaps other extracellular proteases) may mediate neurovascular injury during the acute stages of ... MMP-9 activation and ameliorate t-PA-associated hemorrhage during reperfusion therapy in stroke [38]. The transla- tional attractiveness of this approach lies in the fact that minocycli...
Ngày tải lên: 18/02/2014, 11:20
báo cáo khoa học: "CpG oligonucleotides suppress HepG2 cells-induced Jurkat cell apoptosis via the Fas-FasL-mediated pathway" ppt
... com- mon pathway, and ONY-015 can regulate modulators of the apoptosis pathways [19]. CpG-ODN can activate the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-B) and activated ... activity analysis The activation of caspase-3 is crucial for the intrinsic and extrinsic apoptotic pathways. Accordingly, we selec- tively examined the activity of caspase-3, a...
Ngày tải lên: 10/08/2014, 10:21