Báo cáo lâm nghiệp: "development of winter hardiness of pine and spruce seedlings in a simulated acid rain experimen" potx
Báo cáo lâm nghiệp: "Development of species composition in long term simulations with an individual-tree growth simulator" pps
... site class – mean annual increment at age 100 (m 3 /ha) breast height diameter of tree with mean basal area (dg cm), number of trees (N/ha), basal area (G m 2 /ha), volume (V m 3 /ha) and the ... ecologi- cal demands in site conditions. Acer campestre L., Acer platanoides L. and Acer pseudoplatanus L., the native maple species in Austria, have rather different demands in clim...
Ngày tải lên: 07/08/2014, 03:22
Báo cáo lâm nghiệp: "Development of tertiary roads in the Lednice-Valtice Cultural Landscape" pps
... principles of rural roads and in accordance with function- ally integrated management could be applied in the landscape management of this area and also in similar ones. Keywords: tertiary road; forest ... of management and better utilization of land with 73% increase in hauling road density and 16% increase in rural cart-road density in the period under consid- e...
Ngày tải lên: 07/08/2014, 04:20
Báo cáo lâm nghiệp: "Predicting the environmental thresholds for cambial and secondary vascular tissue development in stems of hybrid aspen" pptx
... variations are the consequence of the balance maintained between the rate of periclinal cambial cell divisions and the rate of differentia- tion of the cells as xylem fibres and parenchyma. In ... of the cambium (active and inactive or dor- mant) may also be regulated by means of a biotic variable to which is linked a critical abiotic variable (such as one of the thr...
Ngày tải lên: 08/08/2014, 00:22
Báo cáo lâm nghiệp: "Development and characteristics of microsatellite markers for sugi (Cryptomeria japonica D. Don) derived from microsatellite-enriched libraries" ppt
... CAATGCCAACTTAGAAGAC 60 30 AB161635 (GA)43 298 Perfect CJS0268 CCTTAGAAAGCTATGCCAC GCAACGCATCCATAATACC 60 30 AB161636 (AC)53 352 Perfect CJS0331 GGAGAGATAGACGACAAAAGAG CCATCTTGCTAATCTGTCC 60 30 AB161637 ... CTAAAGAATAGATGACTCCAC TATAACGCTTTTGCCCTCA 60 30 AB161640 (GA)64 337 Perfect CJS0401 GATCTAAACTTGAGCATAAC CAATCCTGTCTCCATACCC 55 30 AB161641 (CG)8(GA)54 222 Compound CJS0455 GTTACTTTGAAAAATG...
Ngày tải lên: 08/08/2014, 01:22
Báo cáo lâm nghiệp: "Modelling the biomechanical behaviour of growing trees at the forest stand scale. Part I: Development of an Incremental Transfer Matrix Method and application to simplified tree structures" pptx
... simple. In the peripheral layer, where the MS occur, the axial strain increment ( ) can be split into elastic axial strain increment ( ) and axial MS ( ). Generalisation at any point M of is given ... characterise timber quality in Aquitaine maritime pine forests for instance, foresters often look at the stem base leaning and intensity of the basal curvature which provide good i...
Ngày tải lên: 08/08/2014, 01:22
Báo cáo lâm nghiệp: "Improving RBS estimates – effects of the auxiliary variable, stratification of the crown, and deletion of segments on the precision of estimate" pps
... population of paths of each tree (eq. [1]) and the true totals and variances of the target variables and the estimates of the totals, respectively. Choice of the auxiliary variable and variance of the ... data were used: Norway spruce (Picea abies [L.] Karst.), European mountain ash (Sorbus aucuparia L.) and Monterey pine (Pinus radiata D. Don). e results clearl...
Ngày tải lên: 07/08/2014, 03:22
Báo cáo lâm nghiệp: "Contribution to the knowledge of Clethrionomys glareolus populations in forests of managed landscape in Southern Moravia (Czech Republic)" pot
... only in one case in RB locality. e sex ratio was balanced in our case in HL and RB. It is characteristic feature of stable population liv- ing in optimal habitats (A , G 1985). In HL ... m 2 in size, and the mean amount of mast was determined. In all trial plots, the methodology of traditional line trapping was applied (P 1975). Snap traps were us...
Ngày tải lên: 07/08/2014, 03:22
Báo cáo lâm nghiệp: "Contribution to the knowledge of Apodemus sylvaticus populations in forests of the managed landscape of southern Moravia (Czech Republic)" potx
... 0.001, ANOVA, Scheffe test) were significant comparing RB and HA but insignificant comparing HA and HL. Comparing only adult individuals, statistical significance was found between HA and RB individuals ... 370–376 In our case, the sex ratio was markedly in favour of females in HA and HL and balanced in RB. It is a characteristic feature of stable populations living...
Ngày tải lên: 07/08/2014, 03:22
Báo cáo lâm nghiệp: "Stable Agrobacterium-mediated transformation of Norway spruce embryogenic tissues using somatic embryo explants" ppt
... Construction of an intron-containing marker gene: splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium-mediated plant transformation. Molecular and General ... embryos of Nor- way spruce was carried out by Agrobacterium tu- mefaciens strain LBA4404 containing the helper plasmid pAL4404 and binary vector with the gus- intro...
Ngày tải lên: 07/08/2014, 10:21
Báo cáo lâm nghiệp: "Findings from the application of coal combustion by-products (CCB) for forest reclamation on spoil banks of the North Bohemian Brown Coal Basin" pdf
... the age of 7 years by an invariability of the achieved initial state of improvement of physi- cal soil properties (water-retaining capacity, poros- ity) and by a decrease in soil alkalinity and ... and Tilia cordata Mill. (2–15%) whereas the used containerized planting material of Pinus sylvestris L. and Pinus nigra Arn. was characterized by prac- tically no mortality...
Ngày tải lên: 07/08/2014, 10:21