Báo cáo khoa học: " Water extraction by tree fine roots in the forest floor of a temperate Fagus-Quercus forest" pdf

... terms of water storage (in mm per profile). The spatial variability of &thetas; in the forest floor is characterized by an annual mean coefficient of variance of the ... water in the plant-available water potential range, and iii) a marked temporal variability of the water retention capacity. A one-dimensional water flu...

Ngày tải lên: 09/08/2014, 04:20

... grammar, in which the subtrees are specified in advance, in an adaptor grammar the subtrees, as well as their probabilities, are learnt from the train- ing data. In order to make parsing and inference tractable ... Formally, an adaptor gram- mar is a PCFG in which a subset M of the nonter- minals are adapted. An adaptor grammar generates the same set of trees as th...

Ngày tải lên: 20/02/2014, 09:20

... format. Rather, those alternatives that will really make a difference in the adequacy of the parsings of natural-language sentences will be alterations of the format itself in terms of in- ... means that the most significant alterations in grammar rules from the standpoint of natural-language parsing will not be those that affect the formation of particu...

Ngày tải lên: 07/03/2014, 18:20

... MEF2- binding site, 5¢-CTA (A ⁄ T) 4 TAG ⁄ A- 3¢, was located (Fig. 3A) . The introduction of mutations at this site (5¢-CTATAAATAG-3¢ to 5¢-CTATAgccAG-3¢) abolished PGF 2a -induced transcriptional activation (Fig. ... Katsuyama M, Fan C, Arakawa N, Nishinaka T, Miy- agishi M, Taira K & Yabe-Nishimura C (2005) Essen- tial role of ATF-1 in induction of NOX1, a catalytic sub...

Ngày tải lên: 30/03/2014, 03:20

... large number of flies genetically marked by a rare biochemical allele was released in a small, isolated natural population in tropical Africa. Surprisingly, only a slight, short-term ... sample of native flies was taken to determine the allelic frequencies in the natural population. Another sample was taken at the end of release. Du...

Ngày tải lên: 09/08/2014, 22:23

... behavior of k cat as a function of pH, rather than simply increasing with increasing pH. Because of this behavior, k cat ⁄ K M E. G. Funhoff et al. Mutational analysis of His92 in recombinant rat ... and glutamine in recombinant rat PAP (recRPAP) resulted in a sharp decrease in activity [22,23]. Consequently, Asn91 was suggested to be involved in the activation of PA...

Ngày tải lên: 23/03/2014, 13:20

...

Ngày tải lên: 07/08/2014, 15:20

... of radiotherapy. Field definition for radiation therapy in unfavorable, and advanced Hodgkin's lym- phoma was variable and protocol dependent. Although IFRT remained the standard when patients ... treated with combined modality therapy, restricting radiation therapy to areas of initial bulk disease was possible to be used in 15% of the cases (stage III and IV) and in othe...

Ngày tải lên: 09/08/2014, 10:21

... Higuchi et al. [30] to obtain cDNAs encoding M25L–elafin and M63L–trap- pin. For this purpose, forward primers 5¢-CGACTCGA GAAAAGAGCGCAAGAGCCAGTCAA-3¢ and 5¢-CGAC TCGAGAAAAGAGCTGTCACGGGAGTTCCT-3¢ ... wild-type elafin and trappin [15]. Each of the molecules migrated as a single band at 7 kDa (M25L–elafin) and 12 kDa (M63L–trappin) in a reducing SDS ⁄ PAGE gel, indicating homogeneity of...

Ngày tải lên: 19/02/2014, 07:20

... (CAGGACAGCCTGCGCAACGAG), RVR (CAG GACAGGGTGCGCAACGAG), SVR (CAGGACAG CGTGCGCAACGAG) and SLC (AGGGTATCCCTC TGCGATACG), respectively. All the alleles were inserted in pCW between the NdeIandXbaI ... the thin layer chromatography plates, the metabolites were quantified by scraping the radioactive areas and counting with a Wallac 1410 counter. Substrate-induced binding spectra Spec...

Ngày tải lên: 19/02/2014, 12:20