Báo cáo khoa học: "Treatment of symptomatic macromastia in a breast unit" pdf

... effort has already been invested in mathematicalmodelling of the glycolytic pathway in yeast [3–8] and in other organisms, such as Trypanosoma brucei, the parasitethat causes sleeping sickness ... evolutionary effort requiredto develop and maintain this set of biological checks andbalances is intuitively indicative of some importance tomaintaining consistent rates of glucose transport, ... metaboliteconcentration and flux are obtained from populations of yeast cells and so reflect an aggregate of the states of manyindividual organisms. Although no fitted model in thispaper individually...

... Martin et. al. [12] define a transportable NL interface as one that can acquire a new domain model by interacting with a human database expert. Although DATALOG does not yet have such a ... design of natural language interfaces that has evolved during the development of DATALOG, an Eng- lish database query system based on Cascaded ATN grammar. By providing separate representation ... linguistic grammar of English; a general semantic model of database objects and relationships; and a domain model representing the particular concepts of the application domain. After giving a brief...

... geometry of phonological features. Phonology yearbook 2, 225-252. Kalman, Laszl6 and Andras Kornai. 1985. A finite-state approach to generation and parsing. Paper presented at the Generative Grammar ... sequencing of the activation of otherwise distinct coalitions. INFORMATION PROCESSING WITH THE MOLECULAR MACHINE The basic operation performed by the molecular machine is a kind of unification, ... resulting from affixation by supplying missing features (e.g. in vowel harmony), linking or delinking features according to the derived context (e.g. in voice assimilation). Note that delinking...

... that are aimed at characterization of the impactthat these missense THTR1 mutations have on the expres-sion, post-translational modification, plasma membranetargeting and thiamine transport activity. ... expressing the indicated proteins. Netthiamine uptake was calculated by subtraction of the radioactivityobtained at 37 °C with that observed at 4 °C. Endogenous thiaminetransport in NIH3T3 was ... comparison of various members of the solute carrierfamily. Amino-acid alignment of the aspartate 93 in human THTR1with various members of the SLC19 family. The conserved aspartate 93is indicated...

... Takeuchi M, Ogasawara S, Maruyama Y, NakajimaT, Takaoka Y et al. (2002) Production in yeast of alpha-galactosidase A, a lysosomal enzyme applicable toenzyme replacement therapy for Fabry disease. Glyco-biology ... B) Heart – endothelial staining in Fabrymouse; (C, D) lung – epithelial cell stainingincreased in Fabry mouse; (E, F) brain micro-vascular endothelial staining in Fabry mouse.Magnification ... Schinkel AH, Wagenaar E, Mol CA & van Deemter L(1996) P-Glycoprotein in the blood–brain barrier of mice in uences the brain penetration and pharmacologi-cal activity of many drugs. J Clin...

... level). In [10], we have formal- ized this notion by introducing graph adjoining grammars which generate exactly the same lan- guages as TAGs. In a graph adjoining grammar, /~x is represented as ... the main point of the paper. We note that, just as in a TAG, the elementary trees which are the domains of depen- dencies are available as a single unit during each step of the derivation. ... Vijayashanker. A Study of Tee Adjoining Grammars. PhD thesis, University of Penn- sylvania, Philadelphia, Pa, 1987. K. Vijay-Shanker and A. K. Joshi. Fea- ture structure based tree adjoining...

... ...

... double-blind, randomized com-parison of the efficacy and safety of intramuscular injections of olanzapine, lorazepam, or placebo in treating acutely agi-tated patients diagnosed with bipolar mania. ... pharmacokinetics and pharma-cological effects of carbamazepine and carbamazepine10,11-epoxide: An update. Clin Pharmacokinet 1986, 11:177.84. Blackburn SC, Oliart AD, Garcia Rodriguez LA, Perez ... patients needs continuous administra-tion of an antimanic agent [42], but this may be one of theTable 2: Grading of data on the basis of a modified POST methodAgent/modality Acute mania Acute...

... using a digitalcamera (DC120; Eastman Kodak, New Haven, CT, USA)and densitometric scanning analysis software (1d main;Advanced American Biotechnology, Fullerton, CA, USA).Statistical analysisAll ... (bp)CD163(XM_053094.2)Sense:AGCTGGGCTGTGCAGACAACGAntisense:TGAATGACCCCCGAGGATTTCAGC736CYP 1A1 (X00469)Sense:CTGGTTCTGGATACCCAGCTGAntisense:CCTAGGGTTGGTTACCAGG331CYP 1A2 (X01031)Sense:CAGTCACAACAGCCATCTTCAntisense:CCACTGCTTCTCATCATGGT302CYP2B1(XM_342078)Sense:TTGTTTGGTGCTGGGACAGAGAntisense:GGCTAGGCCCTCTCCTGCACA443CYP2E1(M20131)Sense:AAACTTCATGAAGAAATTGACAntisense:TCTCCAACACACACACGCTTTCC311TNF -a (X66539)Sense:GTAGCCCACGTCGTAGCAAAAntisense:CCCTTCTCCAGCTGGAAGAC346IL-6(NM_012589)Sense:GAAAGTCAACTCCATCTGCCAntisense:CATAGCACACTAGGTTTGCC678b-actin(BC063166)Sense:TTGTAACCAACTGGGACGATATGGAntisense:GATCTTGATCTTCATGGTGCTAG764T ... (bp)CD163(XM_053094.2)Sense:AGCTGGGCTGTGCAGACAACGAntisense:TGAATGACCCCCGAGGATTTCAGC736CYP 1A1 (X00469)Sense:CTGGTTCTGGATACCCAGCTGAntisense:CCTAGGGTTGGTTACCAGG331CYP 1A2 (X01031)Sense:CAGTCACAACAGCCATCTTCAntisense:CCACTGCTTCTCATCATGGT302CYP2B1(XM_342078)Sense:TTGTTTGGTGCTGGGACAGAGAntisense:GGCTAGGCCCTCTCCTGCACA443CYP2E1(M20131)Sense:AAACTTCATGAAGAAATTGACAntisense:TCTCCAACACACACACGCTTTCC311TNF -a (X66539)Sense:GTAGCCCACGTCGTAGCAAAAntisense:CCCTTCTCCAGCTGGAAGAC346IL-6(NM_012589)Sense:GAAAGTCAACTCCATCTGCCAntisense:CATAGCACACTAGGTTTGCC678b-actin(BC063166)Sense:TTGTAACCAACTGGGACGATATGGAntisense:GATCTTGATCTTCATGGTGCTAG764T...

... Horse-radish peroxidase-conjugated antibody against caspase-3(#610325) was from BD Pharmigen, and antibody againstb-actin (A5 441) was from Sigma.Statistical analysisAll data are expressed as ... examinedthe main steps involved, following the uptake of satu-rated and unsaturated FFAs into the cells. After theirinternalization, FFAs are converted to fatty acyl-CoA, a reaction catalyzed ... SFA activation is essen-tial for the manifestation of toxicity. It has to be notedthat TrC was not able to inhibit thapsigargin-inducedCtrl3 h12 h24 h 36 h6 hOAOASA/OASA/OASA/OASA/OASA/OASAOAFL1-LogCountsOAOASASASASACtrlCtrlCtrlCtrlCtrlSA...