Báo cáo khoa học: "Non-polypoidal, synchronous mantle- cell lymphoma of small intestine: a rare case" potx
... CAS E REP O R T Open Access Non-polypoidal, synchronous mantle- cell lymphoma of small intestine: a rare case Nikolaos Sikalias 1* , Konstantinos Alexiou 1 , Maria Demonakou 2 , Sylvia- Christina ... cell lymphoma in a tubular adenoma: unusual presentation with synchronous colonic carcinoma. Ann Diagn Pathol 2009, 13(1):47-9. 11. Beppu K, Osada T, Nagahara A, Sakamo...
Ngày tải lên: 09/08/2014, 03:22
... Lymphoma 2002, 43(12):2405-7. 12. Kiyohara T, Kumakiri M, Kobayashi H, Nakamura H, Ohkawara A: Cutaneous marginal zone B -cell lymphoma: a case accompa- nied by massive plasmacytoid cells. J Am Acad ... showed a monoclonal rearrange- ment of IgH chain (Figure 3) and a polyclonal pattern for TCR gamma and beta (data not shown). A final diagnosis of diffuse large cells B -lymp...
Ngày tải lên: 09/08/2014, 07:21
... carcinoma, originally diagnosed as fibroadenoma on a screening mammogram four years before presentation. Diagnosis of clear cell carcinoma was based on certain histological characteristics of the ... The vac- uolated cytoplasm in many of these tumors can be attrib- uted to large quantities of glycogen, as in clear cell carcinomas of the vagina, cervix, endometrium, ovary and s...
Ngày tải lên: 09/08/2014, 07:21
Báo cáo khoa học: "Conservatively treated glassy cell carcinoma of the cervix" pot
... was documented after 21 months since surgery, and was easily managed by cannulation of the cervical canal under anesthesia. Discussion We report a case of early stage glassy cell cancer in a patient, ... vanda.salutari@rm.unicatt.it; Marco Petrillo - afpetrillo@libero.it; Arnaldo Carbone - acarbone@rm.unicatt.it; Giovanni Scambia - giovanni.scambia@rm.unicatt.it * Corresponding aut...
Ngày tải lên: 09/08/2014, 07:21
Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx
... example, asparagine to aspartic acid, or glutamine to glutamic acid changes [14]. The a- conotoxins EpI, PnIA, GIC, GID, AnIA and AnIB contain pairs of asparagine residues [5,10,21,23,24] (Table ... identification of post-translational modifications Isolation and identification Standard procedures for identification and isolation of a- conotoxins generally incorporate separations using re...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: "Shallow parsing on the basis of words only: A case study" pptx
... example. 2.1 Task representation and evaluation method To formulate the task as a machine-learnable classi- fication task, we use a representation that encodes the joint task of chunking and function-tagging ... function tag- ging task is easier thanfindinggrammaticalrelations as we tag a headword of a chunk as e.g. a subject in isolation whereas grammatical relation assign- ment...
Ngày tải lên: 08/03/2014, 07:20
Báo cáo khoa học: "Sentence and Expression Level Annotation of Opinions in User-Generated Discourse" potx
... scheme. At this stage, annotators mark text spans, and are allowed to assign one of the five labels to the marked span: The polar target is used to label the targets of the evaluations implied by polar ... extensions or as it is. Finally, the corpus and the annotation manual will be made available at http://www.ukp.tu-darmstadt.de/ research/data/sentiment-analysis. Acknowledgements This re...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: "Comparing Objective and Subjective Measures of Usability in a Human-Robot Dialogue System" potx
... Litman, C. A. Kamm, and A. Abella. 1997. PARADISE: A framework for evaluating spoken dialogue agents. In Proceed- ings of ACL/EACL 1997. ACL Anthology P97- 1035. M. White, M. E. Foster, J. Oberlander, ... indicated an area of study, the two most common areas were Informatics (12 subjects) and Mathematics (10). On a scale of 1–5, subjects gave a mean assessment of their knowled...
Ngày tải lên: 17/03/2014, 01:20
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... the Hsp9 0a ORF using the forward primer AAATAA GTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC AT CTGCAGTTAGTCTACTTCTTCCAT (Pst...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Investigations on the evolutionary conservation of PCSK9 reveal a functionally important protrusion pot
... marine Califor- nia sea slug (Aplysia californica) and in the freshwater snail Biomphalaria glabrata. These CRD homologs were extracted from ESTs from the Aplysia EST project and the Biomphalaria ... 5) appeared to migrate normally. To study whether the abnormal migration of the mature forms of R19 4A- PCSK9 and D20 4A- PCSK9 was due to altered auto- catalytic cleavage, western blot anal...
Ngày tải lên: 23/03/2014, 07:20