Báo cáo khoa học: "Colorectal carcinoma associated with schistosomiasis: a possible causal relationship" ppsx
... Matsuda K, Masaki T, Ishii S, Yamashita H, Watanabe T, Nagawa H, Muto T, Hirata Y, Kimura K, Kojima S: Possible associations of rectal carcinoma with schistosoma japonicum infection and membranous ... Uthman S, Farhat B, Farah S, Uwayda M: Association of Schistosoma mansoni with colonic carcinoma. Am J Gastroenterol 1991, 86(9):1283-1284. 21. Al-Mashat F, Sibiany A, Radwi A, Bahadu...
Ngày tải lên: 09/08/2014, 03:22
... metastasis to ectopic cervical thymus Majid Mushtaque 1* , Sameer H Naqash 1 , Ajaz A Malik 1 , Rayees A Malik 2 , Samina A Khanday 3 , Parwez S Khan 1 Abstract Papillary carcinoma of thyroid is the ... final approval. RM(Rayees A Malik): Pathological examination of the specimen and Given final approval. SK(Samina A Khanday): Did Sonographic examination of the patient, Interpretat...
Ngày tải lên: 09/08/2014, 01:24
... patient was treated with supplemental oxygen to maintain an oxygen saturation >92% and an additional empirical antimicrobial regimen for suspected health care acquired pneumonia (HCAP) was ... bilaterally, a 4/6 diastolic heart murmur at the lowe r left parasternal area and a 4/6 systolic heart mur- mur at the right upper parasternal area. Laboratory stu- dies revealed a leukocyte...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo khoa hoc:" Chylous ascites associated with chylothorax; a rare sequela of penetrating abdominal trauma: a case report" ppt
... accumulation of fluid and increase in abdominal girth. As the abdominal distension progresses dyspnea, nausea and vague abdominal pain associated with paralytic ileus may occur. Hypovolumia from contin- ued ... effective treatment at initial laparotomy. More commonly the patient's diagnosis is delayed. The majority of these patients can be safely managed by TPN over a variable peri...
Ngày tải lên: 11/08/2014, 10:22
Báo cáo khoa học: "Gallbladder perforation associated with carcinoma of the duodenal papilla: a case report" pdf
... 30:270-4. 10. Ishihara S, Miyakawa S, Takada T, Takasaki K, Nimura Y, Tanaka M, Miyazaki M, Nagakawa T, Kayahara M, Horiguchi A: Status of surgical treatment of biliary tract cancer. Dig Surg ... Moriya T, Kimura W, Hirai I, Mizutani M, Ma J, Kamiga M, Fuse A: Nodal involvement as an indicator of postoperative liver metastasis in carcinoma of the papilla of Vater. J Hepatobiliary Pancr...
Ngày tải lên: 09/08/2014, 03:21
Tài liệu Báo cáo khóa học: Point mutations associated with insecticide resistance in the Drosophila cytochrome P450 Cyp6a2 enable DDT metabolism doc
... (CAGGACAGCCTGCGCAACGAG), RVR (CAG GACAGGGTGCGCAACGAG), SVR (CAGGACAG CGTGCGCAACGAG) and SLC (AGGGTATCCCTC TGCGATACG), respectively. All the alleles were inserted in pCW between the NdeIandXbaI ... in all lanes loaded with bacterial protein. The CYP 6A2 variants have the same apparent molecularmassasCYP 6A2 fromD. melanogaster microsomes. The apoenzyme production varied among the variants. N...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: Endogenous tetrahydroisoquinolines associated with Parkinson’s disease mimic the feedback inhibition of tyrosine hydroxylase by catecholamines doc
... sulfate. Statistical analysis Data are given as mean ± SEM. Mean differences between hTH activities in the absence and presence of PKA were analyzed by an unpaired t test. We used a one-way anova followed ... of patients with PD are unknown, a recent analysis indicated that the average concentration of NMSal in the substantia nigra, caudate nucleus and putamen of individuals without neu...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: "Pelvic mass associated with raised CA 125 for benign condition: a case report" potx
... especially in premenopausal women. Case presentation A 19 year old nulliparous, British Caucasian woman was admitted with a sudden onset of right iliac fossa pain. Urine pregnancy test was negative. ... either pelvic inflammatory disease, endometriotic cyst or an ovarian malignancy was made. She underwent a midline laparotomy that revealed right ovarian cyst (7 × 6 × 6 cm), with as...
Ngày tải lên: 09/08/2014, 03:21
Báo cáo khoa hoc:" Anaphylactic reaction associated with Ranitidine in a patient with acute pancreatitis: a case report" pdf
... Central Page 1 of 2 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case report Anaphylactic reaction associated with Ranitidine in a patient with acute pancreatitis: ... female with acute pancreatitis was admitted under our care. She was known to suffer from diverticular disease and had a myocardial infarction in the past. She was allergic to...
Ngày tải lên: 11/08/2014, 10:22
báo cáo khoa học: " Genomic variants associated with primary biliary cirrhosis" pptx
... Komori A, Yokoyama T, Ueki T, Daikoku M, Yano K, Matsumoto T, Migita K, Yatsuhashi H, Ito M, Masaki N, Adachi H, Watanabe Y, Nakamura Y, Saoshiro T, Sodeyama T, Koga M, Shimoda S, Ishibashi H: Antibody ... 118:145-151. 68. Pares A, Guanabens N, Alvarez L, De Osaba MJ, Oriola J, Pons F, Caballeria L, Monegal A, Salvador G, Jo J, Peris P, Rivera F, Ballesta AM, Rodes J: Collagen type Ia...
Ngày tải lên: 11/08/2014, 12:20