Báo cáo khoa học: "Dramatic regression and bleeding of a duodenal GIST during preoperative imatinib therapy: case report and review" pot

Báo cáo khoa học: "Dramatic regression and bleeding of a duodenal GIST during preoperative imatinib therapy: case report and review" pot

Báo cáo khoa học: "Dramatic regression and bleeding of a duodenal GIST during preoperative imatinib therapy: case report and review" pot

... in any medium, provided the original work is properly cited. Case report Dramatic regression and bleeding of a duodenal GIST during preoperative imatinib therapy: case report and review Andreas ... with a giant GIST of the duodenum. After neoadjuvant imatinib therapy was initiated, a dramatic tumor regression led to an upper gastrointestinal bleedi...

Ngày tải lên: 09/08/2014, 03:21

5 318 0
Tài liệu Báo cáo khoa học: Post-translational modification of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx

Tài liệu Báo cáo khoa học: Post-translational modification of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx

... deubiquitination was visualized by anti- ubiquitin and anti-RhoA immunoblotting. (D) OTUB1-mediated stabilization of active RhoA is impaired during invasion and if co-expressed with YpkA. Active RhoA was enriched ... 168–175. 26 Soares L, Seroogy C, Skrenta H, Anandasabapathy N, Lovelace P, Chung CD, Engleman E & Fathman CG (2004) Two isoforms of otubain 1 regulate T cell anergy...

Ngày tải lên: 16/02/2014, 15:20

16 655 0
Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by fluorescence resonance energy transfer and the role of ATP hydrolysis pptx

Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by fluorescence resonance energy transfer and the role of ATP hydrolysis pptx

... 5¢-CGTTCTTATTACCCTTCTGAA TGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢ and M13C: 5¢-CTACAACGCCTGTAGCATTCCACAGA CAGCCCTCATAGTTAGCGTAACGAGATCG-3¢. Phi-C and Phi-W were complementary to each other. Phi-C was labeled ... strand exchange assay were synthesized by Metabion (Martinsreid, Germany) with the following sequences: PhiC: 5¢-CGATACGCTCAAAGTCA AAATAATCAGCGTGACATTCAGAAGGGTAATAAG AACG-3¢;, PhiW:...

Ngày tải lên: 19/02/2014, 07:20

10 569 0
Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx

Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx

... Zeta, Phi, Tau and O mega [3,4,9]. Whereas Zeta, Theta and Omega classes of GSTs are found in plants and animals, the large Phi and Tau classes a re unique to plants [9]. In maize ( Zea m ays L), 42 ... fractional residual activity of the partial active enzyme intermediate, and k fast and k slow are the rate constants for the slow a nd fast phase of the reaction. Analysi...

Ngày tải lên: 16/03/2014, 16:20

9 557 0
Báo cáo khoa học: Acute intermittent porphyria – impact of mutations found in the hydroxymethylbilane synthase gene on biochemical and enzymatic protein properties pdf

Báo cáo khoa học: Acute intermittent porphyria – impact of mutations found in the hydroxymethylbilane synthase gene on biochemical and enzymatic protein properties pdf

... the principals of the Declaration of Helsinki. Isolation and amplification of DNA Genomic DNA was extracted from peripheral blood leuko- cytes anticoagulated with EDTA according to a standard protocol. ... vector (Amersham Pharmacia Biotech, Uppsala, Sweden) and transformed into E. coli BL21 (DE3) (Strata- gene, La Jolla, CA, USA). Plasmid DNA was amplified and isolated using the...

Ngày tải lên: 23/03/2014, 04:21

10 587 0
Báo cáo khoa học: Structured DNA promotes phosphorylation of p53 by DNA-dependent protein kinase at serine 9 and threonine 18 doc

Báo cáo khoa học: Structured DNA promotes phosphorylation of p53 by DNA-dependent protein kinase at serine 9 and threonine 18 doc

... kinases ataxia telangiectasia mutated gene p roduct and t he ataxia t elangectasia and RAD-3-related kinase promote phosphorylation o f human p53 at Ser15 and Ser20, and are required for the activation ... ataxia telangiectasia mutated gene product (ATM) and the ataxia telangectasia and RAD-3-related kinase (ATR) [1,2] show a redundant specificity for accessible SQ and TQ motif...

Ngày tải lên: 30/03/2014, 15:20

9 321 0
Báo cáo khoa học: Insights into the design of a hybrid system between Anabaena ferredoxin-NADP+ reductase and bovine adrenodoxin pot

Báo cáo khoa học: Insights into the design of a hybrid system between Anabaena ferredoxin-NADP+ reductase and bovine adrenodoxin pot

... a heterologous system that consists of cyanobacterial FNR and adrenal bovine Adx. Anabaena PCC 7119 FNR contains a noncovalently bound FAD group and its main physiological function is the transfer ... the typical absorption spectrum of the CO-ferrous CYP1 1A1 complexed form, characterized by absorbance decreases at 390, 430 and 480 nm and by the appearance of a peak at 45...

Ngày tải lên: 31/03/2014, 07:20

10 400 0
Báo cáo khoa học: " SemiNeo-adjuvant chemo-radiation of rectal cancer with Volumetric Modulated Arc Therapy: summary of technical and dosimetric features and early clinical experience" ppsx

Báo cáo khoa học: " SemiNeo-adjuvant chemo-radiation of rectal cancer with Volumetric Modulated Arc Therapy: summary of technical and dosimetric features and early clinical experience" ppsx

... analysis AR: patient accrual, management and data collection, manuscript proof and study coordination GP: patient accrual, management and data collection, manuscript proof MS: patient accrual, management ... and addition of more planning station, availability of faster hardware and distribution of calculation burden over the planning network are all methods of ‘’adaptation”...

Ngày tải lên: 09/08/2014, 08:22

9 190 0
Báo cáo khoa học: "Semi-robotic 6 degree of freedom positioning for intracranial high precision radiotherapy; first phantom and clinical results" potx

Báo cáo khoa học: "Semi-robotic 6 degree of freedom positioning for intracranial high precision radiotherapy; first phantom and clinical results" potx

... in all 3 translational and rotational axes were calculated separately as was the length of the 3D transla- tional vector. Safety margins for compensation of rigid setup errors and intra-fraction ... available intracranial inter- and intra-fraction data attained by volume imaging of sorts (Additional file 1, Table S1). Comparing these data to invasive frames is no easy matter. In g...

Ngày tải lên: 09/08/2014, 08:23

11 376 0
báo cáo khoa học: "The anti-myeloma activity of a novel purine scaffold HSP90 inhibitor PU-H71 is via inhibition of both HSP90A and HSP90B1" docx

báo cáo khoa học: "The anti-myeloma activity of a novel purine scaffold HSP90 inhibitor PU-H71 is via inhibition of both HSP90A and HSP90B1" docx

... Anderson KC: Tanespimycin monotherapy in relapsed multiple myeloma: results of a phase 1 dose-escalation study. Br J Haematol 150:438-445. 3. Nakashima T, Ishii T, Tagaya H, Seike T, Nakagawa ... The anti-myeloma activity of PU- H71 and the geldanamycin analogues (17-AAG, 17-DMAG), which are all pan-HSP90 inhibitors, was, however, significantly reduced in the absence of gp96. This d...

Ngày tải lên: 10/08/2014, 22:21

8 247 0
w