Báo cáo khoa học: "High-dose chemoradiotherapy followed by surgery versus surgery alone in esophageal cancer: a retrospective cohort study" doc
... Sakai K, Inakoshi H, Sueyama H, Saito M, Sugita T, Tsuchida E, Ito T, Matsumoto Y, Yamanoi T, Abe E, Yamana N, Sasai K: Long-term results of chemoradiotherapy for locally advanced esophageal ... LH, Brown JW: A retrospective analysis of locally advanced esophageal cancer patients treated with neoadjuvant chemoradiation therapy followed by surgery or surgery alone. Ann...
Ngày tải lên: 09/08/2014, 03:21
... 39.6 years (standard deviation 11.3 years). The mean age at onset of psoriasis was 26.8 years (standard deviation 12.1 years) and the mean age at onset of PsA was 33.0 years (standard deviation ... were male and their mean age at onset of the study was 49.7 years. The mean age at onset of psoriasis was 29.3 years (standard deviation 14.2 years) and the mean age at onset of PsA was 38.1 years...
Ngày tải lên: 09/08/2014, 07:20
...
Ngày tải lên: 07/08/2014, 18:21
Tài liệu Báo cáo khoa học: Metabolic flux profiling of Escherichia coli mutants in central carbon metabolism using GC-MS docx
... was expected, as the fractions of pyruvate originating from malate and PEP originating from OAA that are indicative of in vivo malic enzyme and PEP carboxykinase activity, respectively, were already ... of 13 C-labeling patterns in proteinogenic amino acids by NMR analysis, and provides direct evidence for a particular flux. Global isotopic data interpretation by isotopomer balancing...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: Purple membrane lipid control of bacteriorhodopsin conformational flexibility and photocycle activity An infrared spectroscopic study docx
... surface under the loop region containing the charged acidic amino acids should produce a strain limiting the mobility of both the amino-acid-containing loops and the attached transmem- brane a- helices. ... the wavelength of maximum absorbance were performed on a Cary 14DS spectrophotometer. Kinetic bacteriorhodopsin photocycle data, after an actinic light flash, were obtained and analyze...
Ngày tải lên: 17/03/2014, 03:20
Báo cáo khoa học: Differential susceptibility of Plasmodium falciparum versus yeast and mammalian enolases to dissociation into active monomers doc
... Plasmodium falciparum versus yeast and mammalian enolases to dissociation into active monomers Ipsita Pal-Bhowmick, Sadagopan Krishnan and Gotam K. Jarori Department of Biological Sciences, Tata Institute ... enolase polypeptide chain folds into two domains, with the small domain having a mixture of a- helices and b-sheets, and the large domain having an a ⁄ b-barrel structure (Fig. 8D...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo khoa học: The light-harvesting antenna of the diatom Phaeodactylum tricornutum Evidence for a diadinoxanthin-binding subcomplex doc
... study was conducted on the C. meneghiniana LHC, in which two FCP fractions, A and B (B having a larger appar- ent molecular mass than A) , were separated by using sucrose gradients [21]. Fraction A ... exchanged on a PD-10 column (Amersham Pharmacia, 91898, Saclay, France) against low-salt or high- salt buffers before loading on appropriate gradients. Centrifugation was performed...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo khoa học: "The expression of plasmid mediated afimbrial adhesin genes in an avian septicemic Escherichia coli strain" doc
... [31] EHEC chuA GACGAACCAACGGTCAGGAT TGCCGCCAGTACCAAAGACA 279 [7] E. coli K12 yjaA TGAAGTGTCAGGAGACGCTG ATGGAGAATGCGTTCCTCAAC 211 [7] EHEC TspE4.C2 GAGTAATGTCCGGGGCATTCA CGCGCCAACAAAGTATTACG 152 ... [19] APEC csgA ACTCTGACTTGACTATTACC AGATGCAGTCTGGTCAAC 200 [22] UPEC afa GCTGGGCAGCAAACTGATAACTCTC CATCAAGCTGTTTGTTCGTCCGCCG 710 [4] UPEC sfa CTCCGGAGAACTGGGTGCATCTTAC CGGAGGAGTAATTACAAACCTGGC...
Ngày tải lên: 07/08/2014, 20:23
Báo cáo khoa học: "Association between intratumoral lymphatic microvessel density (LMVD) and clinicopathologic features in endometrial cancer: a retrospective cohort study" pdf
... and peritumoral lymphatic vascular density in early-stage invasive cervical carcinomas. Both intravascular and peritumoral high LMVD were associated with lymph node metastasis [8]. In a conflicting study, ... (LMVD) and clinicopathologic features in endometrial cancer: a retrospective cohort study Lecy Kawamura 1 , Filomena M Carvalho 2* , Bernardo GL Alves 2 , Carlos E Bacchi...
Ngày tải lên: 09/08/2014, 03:22
Báo cáo khoa học: "Evaluation of clinical, laboratory and morphologic prognostic factors in colon cancer" ppsx
... Tominaga T, Sakabe T, Koyama Y, Hamano K, Yasutomi M, Takahashi T, Kodaira S, Kato T, Ogawa N: Prognostic factors for patients with colon or rectal carcinoma treated with resection only. Cancer ... M0. Data analysis Medical records of patients with colon cancer were iso- lated in a computerized database. The database included 53 demographics, clinical, laboratory and patho-morpho- logical...
Ngày tải lên: 09/08/2014, 07:21