Báo cáo khoa học: "Combination therapy with docetaxel and S-1 as a first-line treatment in patients with advanced or recurrent gastric cancer: a retrospective analysis" docx
Báo cáo khoa học: "The effect of external beam radiotherapy volume on locoregional control in patients with locoregionally advanced or recurrent nonanaplastic thyroid cancer" ppsx
... recurrence within a tumor bed or nodal areas in the cervical neck and the upper mediastinum, and distant metastasis was defined as any recurrence outside of the cervical neck and the upper mediastinum. ... patients had locoregionally recurrent disease. Five (22%) patients had a distant metastasis which was controlled with stable disease at pre-EBRT and these patient...
Ngày tải lên: 09/08/2014, 09:20
báo cáo hóa học: " Comparing the SF-12 and SF-36 health status questionnaires in patients with and without obesity" pot
... pub- lication from the participants and/ or their relatives as approved by the IRB. Data Collection and Measures The telephone interview was administered by trained interviewers and ascertained information ... study, analyzed and interpreted the data and drafted the manuscript. RD and MBH contributed to the design and interpretation of the analysis. All authors read and cri...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo khoa học: "Combination therapy with docetaxel and S-1 as a first-line treatment in patients with advanced or recurrent gastric cancer: a retrospective analysis" docx
... the docetaxel and S-1 combination as a first-line treatment for patients with advanced or recurrent gastric cancer and to analyze prognostic factors in these patients. Patients and methods Patients The ... recog- nized as the standard chemotherapy regimen for advanced or recurrent gastric cancer in Japan. Docetaxel has shown promising activit...
Ngày tải lên: 09/08/2014, 03:21
Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx
... the plasmid pCY167 (Suzuki H & Yamada C, Unpublished), using forward primer 5¢- CATATGGATGAGTACAAACA AGTAGATG-3¢ and reverse primer 5¢- GGATCCTCGAG CTCATTTACGTTTTAAATTAATGCCGAT-3¢ (underlin- ed ... the solvation, owing to increased water-binding capacity. This may allow the protein to remain in a hydrated state, preventing the binding of inorganic cations in the high-salt solution...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo khoa học: X-ray structure of glucose/galactose receptor from Salmonella typhimurium in complex with the physiological ligand, (2R)-glyceryl-b-D-galactopyranoside pdf
... 3, 360–363. 15 Anraku Y (1968) Transport of sugars and amino acids in bacteria. I. Purification and specificity of the galac- tose- and leucine-binding proteins. J Biol Chem 243, 3116–3122. 16 Vyas NK, Vyas ... forms are common in both plants and animals. Interestingly, GGal is also a good substrate for all three components of the lac operon, i.e. b-galacto- sidase, the lactose tr...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: "Combination of an Automatic and an Interactive Disambiguation Method" docx
... Humall- computer interaction for semantic disambigua- tion. Ill Proccedings of COLING-90, pages 42-47. II. Maruyama and H. Watanabe. 1990. All interac- tive Japanese parser for machine trallslation. ... 2: An example of the tree of candidates for one ambiguous word in an input sentence The accuracy of the interactive disambiguatiou /~ntr and that of the automatic disambiguation P...
Ngày tải lên: 23/03/2014, 19:20
Báo cáo y học: "Changes of uterine blood flow after vaginal radical trachelectomy (VRT) in patients with early-stage uterine invasive cervical cancer"
... patient 2 was also within the normal range over the pregnancy period. Fig. 4 shows changes of cervical length as measured by transvaginal ultrasonography in the both patients. The remaining ... cervical cancer Kota Umemura 1 , Shin-ichi Ishioka 1 , Toshiaki Endo 1 , Tsuyoshi Baba 1 , Yoshiaki Ezaka 1 , Kunihiko Naga- sawa 1 , Madoka Takahashi 1 , Masahito Mizuuchi 1 , Nanako Iw...
Ngày tải lên: 25/10/2012, 11:48
Báo cáo khoa học: MicroRNA-143 reduces viability and increases sensitivity to 5-fluorouracil in HCT116 human colorectal cancer cells potx
... was associated with decreased viability and increased cell death after exposure to 5-fluorouracil. These changes were associated with increased nuclear fragmentation and caspase -3, -8 and -9 activities. ... is activated and acts as a survival factor in mitosis. Cell Signal 19, 1964–1972. 31 Nakagawa Y, Iinuma M, Naoe T, Nozawa Y & Akao Y (2007) Characterized mechanism of...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... dissociation rate constant at an insignificant change in the association rate constant (Fig. 4, D2 and D1, respectively). Also, at pH 8.5, the rebinding study reveals an increase in the association and ... tri- liganded HbA. Time courses for O 2 rebinding are shown in Figs 1 and 2. The transient absorption decays were analyzed using a standard least-squares technique using home-...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Glycogen synthase kinase 3b and b-catenin pathway is involved in toll-like receptor 4-mediated NADPH oxidase 1 expression in macrophages ppt
... Ya- mamoto Y, Kawai T, Teshima-Kondo S, Tanahashi T & Rokutan K (2009) Interleukin 10 inhibits interferon gamma- and tumor necrosis factor alpha-stimulated activation of NADPH oxidase 1 in ... and the b-cate- nin pathway are crucial regulators in the balance between pro- and anti -in ammatory cytokine produc- tion [25]. Recently, this pathway was shown to have an essential role...
Ngày tải lên: 22/03/2014, 21:21