Báo cáo khoa học: "Evapotranspiration measurements in a Mediterranean forest stand by means of ecophysiological and microclimatic techniques" ppsx

... balance/Bowen Evapotranspiration measurements in a Mediterranean forest stand by means of ecophysiological and microclimatic techniques R. Valentini, G.E. Scarascia-Mugnozza M. Sabatti Istituto ... stand av- erages 2400 sprouts and 97 standards of 2 age classes per ha (corresponding to the double and single harvesting cycle, respectively)....

Ngày tải lên: 09/08/2014, 02:21

... resulting from increasing greenhouse gases in the atmosphere may counteract this increase in carbon accumulation in soils by stimulating the mineralization rate of organic carbon pools ... 0.6 ha and is mainly composed of 30-year-old beeches. Herbaceous understory vegeta- tion is rather sparse. Average annual precipitation and air temperature...

Ngày tải lên: 08/08/2014, 14:21

... remaining fine root necromass 2 years after trenching to initial fine root biomass and necromass indicated that 53 % of killed fine roots disap- peared within 2 years ... was estimated by coring and sorting remaining dead roots in the trenched plots 2 years after trenching. The remaining fine root necromass was then compared to initial ......

Ngày tải lên: 08/08/2014, 14:21

... class="bi x0 y0 w0 h0" alt="" Original article Aboveground biomass in a beech forest and a Scots pine plantation in the Sierra de la Demanda area of northern Spain I Santa ... results indicate a total biomass of 152.1 mg ha-1 in the pine forest and 134.2 mg ha-1 in the beech forest, and litter fall was 5 791 kg ha-1 in the...

Ngày tải lên: 08/08/2014, 18:21

... within the tail downstream of the thrombin cleavage site in the N-terminal extension containing the His tag) was observed at a crystal lattice interface between in the PAH and FPAH complexes. In ... a barrel domain preceded by an N-terminal a + b domain [6]. The catalytic site is contained completely within a single subunit and lies at the interface of the two domains:...

Ngày tải lên: 23/03/2014, 07:20

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk. The resulting PCR prod- ucts, ... (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢)...

Ngày tải lên: 19/02/2014, 17:20

... Introduction In this paper we investigate how features of a text discovered via automatic event extraction can be used in both natural language understanding and advice generation in the domain of narrative ... Between Rater A and B there was a Cronbach’s α statistic of .90 and a Kendall’s τ b statistic of .74. Between Rater B and C there was a Cronbach’s α sta...

Ngày tải lên: 20/02/2014, 12:20

... represented as: ANIMALS 2-LE MAMMALS PERSONS DOGS T GEORGE1 In addition, let us assume we know that all instances of 2-LEGGED-ANIMALS have two legs and that all instances of MAMMALS are warm-blooded: ... of a natural language system is that it often has only partial information about the individuals (objects, events, and relations) that are talked about. Unless one ass...

Ngày tải lên: 21/02/2014, 20:20

... containing parallel items, and abstracts over these items in both representations. If the resulting representations are unifiable, the two sen- tences stand in a contrast relation and the parallel ... This means that although theoretically appealing, the HOU approach to contrastive accent is less attractive from a computational viewpoint. 3 An alternative solution Fortu...

Ngày tải lên: 22/02/2014, 03:20

... relevant sentence readings in a compact way. We also compile each grammar rule into a finite state automaton. Each rule automaton can be regarded as a constraint that accepts some readings and ... more in length, one of which is a finite verb, and (ii) a varying number of nominal and adver- bial constructs. Verbs and nominal heads in a fi- nite clause are i...

Ngày tải lên: 22/02/2014, 10:20