Báo cáo khoa học: "Greenhouse production of nectarines for early harvest in France: a cultivation system with shallow rest or no rest" pps

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 10482 10661 179 1G4P217 Group 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 92.1 ± 0.57 73.6 ± 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT GCTA...

Ngày tải lên: 14/02/2014, 19:20

12 796 0
Tài liệu Báo cáo khoa học: Animal models of amyloid-b-related pathologies in Alzheimer’s disease docx

Tài liệu Báo cáo khoa học: Animal models of amyloid-b-related pathologies in Alzheimer’s disease docx

... pathogenesis Familial forms of AD, with an autosomal dominant mode of inheritance, account for < 2% of all AD cases. Onset is most often before 65 years of age, and the penetrance is nearly always complete. ... expressing wild-type (wt) human APP are of interest because the great majority of sporadic AD patients do not carry any disease causing APP mutation. In early tr...

Ngày tải lên: 16/02/2014, 09:20

21 560 0
Tài liệu Báo cáo khoa học: Quantitative estimation of channeling from early glycolytic intermediates to CO2 in intact Escherichia coli pdf

Tài liệu Báo cáo khoa học: Quantitative estimation of channeling from early glycolytic intermediates to CO2 in intact Escherichia coli pdf

... The 3 Hin protein was insignificant, showing that the aminoacyl- tRNA made from amino acids and tRNA did not mix with the introduced aminoacyl-tRNA; i.e. there was perfect channeling from free amino acids ... amino acids. The quan- tities of [ 14 C]aminoacyl-tRNA (made in the pathway from 14 C-labeled amino acids), [ 3 H]aminoacyl-tRNA, 14 C- and 3 H-labeled protein were measured. The 3...

Ngày tải lên: 19/02/2014, 18:20

10 438 0
Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

... chemiluminescence using an ECL kit. For densitometric analysis, data were captured using a Fuji LAS-1000 Imaging System CCD camera (aida 2.11 soft- ware for analysis). ACE2 ⁄ ACE activity assays Fluorogenic ... have K481/R489 W477/485 D499/507 R169/186 W478/486 Y207/224 E398/P407 R514/522 S511/P519 B A Fig. 6. Chloride binding to ACE2 (yellow) and tACE (white). (A) Binding site of...

Ngày tải lên: 20/02/2014, 01:20

9 789 2
Tài liệu Báo cáo khoa học: "Automatic Identification of Pro and Con Reasons in Online Reviews" ppt

Tài liệu Báo cáo khoa học: "Automatic Identification of Pro and Con Reasons in Online Reviews" ppt

... done in this par- ticular vein partly because there is no annotated data. Labeling each sentence is a time- consuming and costly task. In this paper, we pro- pose a framework for automatically ... summarization that important sentences that contain topics in a text have cer- tain positional patterns in a paragraph (Lin and Hovy, 1997), which may apply because reasons l...

Ngày tải lên: 20/02/2014, 12:20

8 461 1
Tài liệu Báo cáo khoa học: "Automatic clustering of collocation for detecting practical sense boundary" ppt

Tài liệu Báo cáo khoa học: "Automatic clustering of collocation for detecting practical sense boundary" ppt

... large-scaled corpus contains semantic information. The collocation for ambiguous words also contains semantic information about multiple senses for this ambiguous word. This paper uses the ambiguity ... adjusted by the analyzing the appearing senses from the Semcor. For the evaluation of Korean we used Korean Unabridged Dictionary (KD) for fine-grained senses and Yonsei Dict...

Ngày tải lên: 20/02/2014, 16:20

4 425 0
Báo cáo khoa học: The role of evolutionarily conserved hydrophobic contacts in the quaternary structure stability of Escherichia coli serine hydroxymethyltransferase pptx

Báo cáo khoa học: The role of evolutionarily conserved hydrophobic contacts in the quaternary structure stability of Escherichia coli serine hydroxymethyltransferase pptx

... shows that the apparent K d values calculated from least square fitting of experimental data points to Eqn (2) are essentially the same for all enzyme forms. The cal- culated relative fluorescence intensities ... structure of the enzyme. The tertiary structure of all apo- and holo-forms was analyzed measuring and comparing their near-UV CD spectra at a subunit concentration of 35 lm...

Ngày tải lên: 07/03/2014, 03:20

12 579 0
Báo cáo khoa học: Different roles of two c-tubulin isotypes in the cytoskeleton of the Antarctic ciliate Euplotes focardii Remodelling of interaction surfaces may enhance microtubule nucleation at low temperature doc

Báo cáo khoa học: Different roles of two c-tubulin isotypes in the cytoskeleton of the Antarctic ciliate Euplotes focardii Remodelling of interaction surfaces may enhance microtubule nucleation at low temperature doc

... resuspended in distilled water, and used as template for PCR; the program was 30 cycles at 94 °C for 50 s, 48 °C for 1 min, and 72 °C for 1 min. A final incubation at 72 °C for 7 min was added to the last ... 45 cycles of denaturation at 95 °C for 30 s and annealing and extension at 60 °C for 15 s each. Following amplification, melting curve analysis of the DNA was perform...

Ngày tải lên: 07/03/2014, 04:20

16 468 0
Báo cáo khoa học: Molecular imprinting of cyclodextrin glycosyltransferases from Paenibacillus sp. A11 and Bacillus macerans with c-cyclodextrin pptx

Báo cáo khoa học: Molecular imprinting of cyclodextrin glycosyltransferases from Paenibacillus sp. A11 and Bacillus macerans with c-cyclodextrin pptx

... reaction mixture was incubated for 30 min at 40 ° C. The reaction was stopped by boiling for 10 min. An aliquot (0.5 mL) was incubated with 2.0 mL of a solution containing 1.0 mL of 4 mm phenolphthalein in ... Terada et al. [21] observed that the amount of CD 8 increased when a CGTase from Bacillus sp. A2 - 5a was incubated with starch for a long period of time, as...

Ngày tải lên: 07/03/2014, 10:20

10 562 0
Báo cáo khoa học: Identification of small scale biochemical networks based on general type system perturbations pdf

Báo cáo khoa học: Identification of small scale biochemical networks based on general type system perturbations pdf

... genomic, proteomic and metabolic information that describe the state of a cell. These data-sets call for systematic methods enabling relevant information about the inner workings of the cell to be extracted. ... per- formed around the same steady-state, as only then an averaging effect in the determination of A d can be avoided. Small variations of the initial state around the...

Ngày tải lên: 07/03/2014, 17:20

11 451 0
w