Báo cáo khoa học: "FIBRE : a French PC-based regional forest sector model applied to Burgundy" docx

Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

... Natural Language Generation, Niagara-on-the-lake/Canada, 1998. G. Helbig, J. Buscha. Deutsche Grammatik: Ein Handbuch f~r den AusMnderunterricht. Berlin, Leipzig: Langenscheidt, Verlag Enzyklop~.die, ... summary of the situation. Their 'test for relational phrases' is a good start, but geared towards the English language (we are investigat- ing German as well), and furtherm...

Ngày tải lên: 20/02/2014, 18:20

5 528 0
Báo cáo khoa học: "Multilingual Computational Semantic Lexicons in Action: The WYSINNWYG Approach to NLP" docx

Báo cáo khoa học: "Multilingual Computational Semantic Lexicons in Action: The WYSINNWYG Approach to NLP" docx

... lexical processor to specialise or generalise the meaning of a lexeme, for a particu- lar task and on a needed basis. Formally, generalisa- tion and specialisation can be done in various ways, ... "right" lexical data already tuned towards a particular task. In order to do so, I argue for a lexical semantic approach to lex- icon representation. I exemplify my s...

Ngày tải lên: 08/03/2014, 06:20

7 356 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf

... H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... kinase; HA, haemagglutinin; HAI-1, hepatocyte growth factor activator inhibitor type 1; HAI-2, hepatocyte growth factor activator inhibitor type 2; HGF, hepatocyte growth factor; HGFA, hepatocyte gro...

Ngày tải lên: 15/02/2014, 01:20

13 641 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx

... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... supernatant after 4 days of growth, subsequent preparative HPLC frac- tionation and chromazurol S (CAS: an indicator of iron scavenging properties) liquid assay analysis of...

Ngày tải lên: 16/02/2014, 09:20

14 614 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf

... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sample and acceptor beads in the...

Ngày tải lên: 18/02/2014, 14:20

9 457 0
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt

... Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (2003) Interferon -a sensitizes human hepatoma cells to TRAIL-induced apoptosis through DR5 upregulation ... increased apoptosis seen in response to IFNa plus TRAIL is characterized by elevated caspase-8 and caspase-9 activity, with enhanced degradation of BID and translocation of Bax to mi...

Ngày tải lên: 19/02/2014, 06:20

11 679 0
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... truncated fragments of TbPDE1 were also amplified using the same protocol and pET-PDE1 as template. PDE1(Arg189–Thr620) was amplified using...

Ngày tải lên: 19/02/2014, 12:20

11 566 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... were analyzed and quantified on a Fuji Bio-Imaging analyzer BAS-2500 using IMAGE GAUGE V3.3 software. Chromatin and protein–DNA analysis Micrococcal nuclease (MNase) digestion and in situ cleavage by ... TSA was added, at the same time, to a pool of injected oocytes, these are referred to as late TSA (L). Transcription was allowed to continue for 6 h. Oocytes were harvested and total...

Ngày tải lên: 19/02/2014, 12:20

10 501 0
Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx

Tài liệu Báo cáo khoa học: "Creating a manually error-tagged and shallow-parsed learner corpus" pptx

... Computational Linguistics Creating a manually error-tagged and shallow-parsed learner corpus Ryo Nagata Konan University 8-9-1 Okamoto, Kobe 658-0072 Japan rnagata @ konan-u.ac.jp. Edward Whittaker ... ACL, pages 241–248. Katsuaki Okihara. 1985. English writing (in Japanese). Taishukan, Tokyo. Alla Rozovskaya and Dan Roth. 201 0a. Annotating ESL errors: Challenges and rewords. In Proc. of N...

Ngày tải lên: 20/02/2014, 04:20

10 467 0
Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

Tài liệu Báo cáo khoa học: "MemeTube: A Sentiment-based Audiovisual System for Analyzing and Displaying Microblog Messages" pdf

... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptually, ... animation with automatic piano playing. 5 Animation Generation In this final stage, our system produces real-time animation for visualization. The streams of mes- sages are designed to flo...

Ngày tải lên: 20/02/2014, 05:20

6 449 0
Từ khóa:
w