Báo cáo khoa học: "FIBRE : a French PC-based regional forest sector model applied to Burgundy" docx

... Natural Language Generation, Niagara-on-the-lake/Canada, 1998. G. Helbig, J. Buscha. Deutsche Grammatik: Ein Handbuch f~r den AusMnderunterricht. Berlin, Leipzig: Langenscheidt, Verlag Enzyklop~.die, ... summary of the situation. Their 'test for relational phrases' is a good start, but geared towards the English language (we are investigat- ing German as well), and furtherm...

Ngày tải lên: 20/02/2014, 18:20

... lexical processor to specialise or generalise the meaning of a lexeme, for a particu- lar task and on a needed basis. Formally, generalisa- tion and specialisation can be done in various ways, ... "right" lexical data already tuned towards a particular task. In order to do so, I argue for a lexical semantic approach to lex- icon representation. I exemplify my s...

Ngày tải lên: 08/03/2014, 06:20

... H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor. ... kinase; HA, haemagglutinin; HAI-1, hepatocyte growth factor activator inhibitor type 1; HAI-2, hepatocyte growth factor activator inhibitor type 2; HGF, hepatocyte growth factor; HGFA, hepatocyte gro...

Ngày tải lên: 15/02/2014, 01:20

... from bacterial genomics. Nat Prod Rep 24, 1073–1109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-converting enzyme, ... supernatant after 4 days of growth, subsequent preparative HPLC frac- tionation and chromazurol S (CAS: an indicator of iron scavenging properties) liquid assay analysis of...

Ngày tải lên: 16/02/2014, 09:20

... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide Biotin-AACGACGGTCGCTCCGCCTGGCT 140 40 60 80 100 120 Counts ... procedure The assay was run as a three-step assay: initial incubation of the sample and probe, addition and incubation of the sample and acceptor beads in the...

Ngày tải lên: 18/02/2014, 14:20

... Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H, Hamasaki K et al. (2003) Interferon -a sensitizes human hepatoma cells to TRAIL-induced apoptosis through DR5 upregulation ... increased apoptosis seen in response to IFNa plus TRAIL is characterized by elevated caspase-8 and caspase-9 activity, with enhanced degradation of BID and translocation of Bax to mi...

Ngày tải lên: 19/02/2014, 06:20

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... truncated fragments of TbPDE1 were also amplified using the same protocol and pET-PDE1 as template. PDE1(Arg189–Thr620) was amplified using...

Ngày tải lên: 19/02/2014, 12:20

... were analyzed and quantified on a Fuji Bio-Imaging analyzer BAS-2500 using IMAGE GAUGE V3.3 software. Chromatin and protein–DNA analysis Micrococcal nuclease (MNase) digestion and in situ cleavage by ... TSA was added, at the same time, to a pool of injected oocytes, these are referred to as late TSA (L). Transcription was allowed to continue for 6 h. Oocytes were harvested and total...

Ngày tải lên: 19/02/2014, 12:20

... Computational Linguistics Creating a manually error-tagged and shallow-parsed learner corpus Ryo Nagata Konan University 8-9-1 Okamoto, Kobe 658-0072 Japan rnagata @ konan-u.ac.jp. Edward Whittaker ... ACL, pages 241–248. Katsuaki Okihara. 1985. English writing (in Japanese). Taishukan, Tokyo. Alla Rozovskaya and Dan Roth. 201 0a. Annotating ESL errors: Challenges and rewords. In Proc. of N...

Ngày tải lên: 20/02/2014, 04:20

... We also integrate the sentiment-detection system with a real-time rule-based harmonic music and animation generator to display streams of messages in an audiovisual format.  Conceptually, ... animation with automatic piano playing. 5 Animation Generation In this final stage, our system produces real-time animation for visualization. The streams of mes- sages are designed to flo...

Ngày tải lên: 20/02/2014, 05:20