báo cáo khoa học: "Primary retroperitoneal mucinous cystadenoma of borderline malignancy in a male patient Case report and review of the literature" pdf
báo cáo khoa học: "Primary retroperitoneal mucinous cystadenoma of borderline malignancy in a male patient. Case report and review of the literature" pdf
... this article as: Falidas et al.: Primary retroperitoneal mucinous cystadenoma of borderline malignancy in a male patient. Case report and review of the literature. World Journal of Surgical Oncology ... Matsubara M, Sciozawa T, Tachibana R, Hondo T, Osasda K, Kawaguchi K, Kimura K, Konishi I: Primary retroperitoneal mucinous cystadenoma of borderline...
Ngày tải lên: 09/08/2014, 02:21
báo cáo khoa học: "Sentinel lymph node biopsy for high-risk cutaneous squamous cell carcinoma: clinical experience and review of literature" ppsx
... high-risk features as shown in Table 1. The diagnosis of SCC was verified on histological examination and all patients had no clinical evidence of nodal metas- tases on physical examination or imaging ... combined into larger institutional case series resulting in a total of 130 evaluable cases (Table 2). All of the studies, except Hatta et al. [30] clearly designated cu...
Ngày tải lên: 09/08/2014, 02:20
Báo cáo khoa học: "Primary appendiceal mucinous adenocarcinoma alongside with situs inversus totalis: a unique clinical case" pps
... con- stitutes a scarce malignancy of the appendix and often associated with a second GI malignancy of the gastroin- Figure 1 Representative areas of the mucinous adenocarcinoma of the appendix (H&E ... preoperatively and, not as much of than 50% of cases are diagnosed dur- ing intraoperative exploration of the peritoneal cavity [4]. Diagnosis of muc...
Ngày tải lên: 09/08/2014, 03:21
Tài liệu Báo cáo khoa học: "Know When to Hold''''Em: Shuffling Deterministically in a Parser for Non concatenative Grammars*" pdf
... most appropriate parsing algorithm to take advantage of the information that a semantic head provides. For example, a head usually provides information about the remaining daughters that the ... outstanding features of parsers of this type are that they are head-driven, of course, and that they process the string bidirectionally, starting from a lexical head and...
Ngày tải lên: 20/02/2014, 18:20
Báo cáo khoa học: 7,8-Diaminoperlargonic acid aminotransferase from Mycobacterium tuberculosis, a potential therapeutic target Characterization and inhibition studies pptx
... ribosome-binding site, and 5¢-GCAAGCTTTCATGGCAGTGAGCCTACG AGCCG-3¢ containing a HindIII restriction site. For the His 6 -tagged bioA gene, the primers were the following: 5¢- CGCGCGAATTCAGGAGGAATTTAAAATGCACCAC CACCACCACCACGCTGCGGCGACTGGCG-3¢ ... others for the inactivation of c-aminobutyric acid transaminase [32], d-amino acid aminotransferase [33], and alanine racemase [34] b...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: Enhanced sensitivity to hydrogen peroxide-induced apoptosis in Evi1 transformed Rat1 fibroblasts due to repression of carbonic anhydrase III docx
... knockdown of caIII mRNA and protein and enhanced caspase 3 catalytic activity in Rat1 cells. Fig. S2. DsiRNA-mediated knockdown of caIII mRNA and protein and caspase 3 catalytic activity in Rat1 cells ... TAMRA rat caIII probe: cttcaccacgccaccctgc gag 5¢ rat gapdh: gggcagcccagaacatca 3¢ rat gapdh: ccgttcagctctgggatgac 5¢ 6-FAM, 3¢ TAMRA rat gapdh probe: ccctgcatccactgg tgctgcc...
Ngày tải lên: 29/03/2014, 08:20
Báo cáo khoa học: Transfection with 4-hydroxynonenal-metabolizing glutathione S-transferase isozymes leads to phenotypic transformation and immortalization of adherent cells pdf
... with active protein began to round up and detach (Fig. 2A, a- p and a- f), whereas those injected with OG-dextran and inactive protein remained flat and attached (Fig. 2A, m-p and m-p & f). There ... Akhand, A. A., Hayakawa, A. , Suzuki, H., Miyata, T., Kurokawa, K., Hotta, Y., Ishikawa, N. & Naka- shima, I. (2000) 4-Hydroxynonenal induces a cellular redox status- relat...
Ngày tải lên: 30/03/2014, 13:20
Báo cáo khoa học: " Acupuncture treatment for idiopathic Horner''''s syndrome in a dog" doc
... protein, and urine analysis were normal. The radiological examination showed no evi- dence of external trauma or other radiographic problems. A pharmacological test to locate the cause of Horner’s ... enophthalmos, and prolapsed nictitans for 2 days following sudden onset. According to history taking, ophthalmic, neurological, and radiological examination, the patient...
Ngày tải lên: 07/08/2014, 20:23
Báo cáo khoa học: "A rare case of isolated wound implantation of colorectal adenocarcinoma complicating an incisional hernia: case report and review of the literature" pdf
... Oncology Open Access Review A rare case of isolated wound implantation of colorectal adenocarcinoma complicating an incisional hernia: case report and review of the literature Aninda Chandra*, Lester ... hernia and presented in the anterior abdom- inal wall. Tumour markers were negative and there was no intra-abdominal pathology. Wound implantation in an incis...
Ngày tải lên: 09/08/2014, 07:21
báo cáo khoa học: "Reconsidering low-dose aspirin therapy for cardiovascular disease: a study protocol for physician and patient behavioral change" pot
... participated in the design of the study and the patient activation form and helped to draft the manuscript. All authors read and approved the final manuscript. Competing interests The authors declare ... by a study team member to allocate them to the patient activation, clinician-only reminder, and academic detailing alone groups. The consort diagram of num...
Ngày tải lên: 10/08/2014, 11:20