báo cáo khoa học: "Nulliparity enhances the risk of second primary malignancy of the breast in a cohort of women treated for thyroid cancer" ppsx

... RESEARCH Open AccessNulliparity enhances the risk of second primary malignancy of the breast in a cohort of women treated for thyroid cancerFabrizio Consorti1*, Gianluca Di Tanna2, Francesca ... Francesca Milazzo1and Alfredo Antonaci1AbstractBackground: Many studies have reported an increased risk of developing a second primary malignancy (SPM) of the breast in women treated for thyroid ... 109:57-66.doi:10.1186/1477-7819-9-88Cite this article as: Consorti et al.: Nulliparity enhances the risk of second primary malignancy of the breast in a cohort of women treated for thyroid cancer. World Journal of Surgical Oncology...

Báo cáo khoa học: "Combining POMDPs trained with User Simulations and Rule-based Dialogue Management in a Spoken Dialogue System" docx

... (section 4). The appli-cation domain is a tourist information system for accommodation and events in the local area. The domain of the trained DMs is identical to that of a rule-based DM that was used ... database concentrates heterogeneoustypes of information at various levels of descrip-tion in a uniform way. This facilitates dialog eval-uation, data mining and online learning becausedata is ... candidate se-mantic parses using the semantics of a domain on-tology and the output of ASR. The visualization of the internal representation of the POMDP-DM includes the N best dialoguestates after...

Báo cáo khoa học: "Flowering and cone production variability and its effect on parental balance in a Scots pine clonal seed orchard" docx

... followingAskew and Blush (1990). The index was esti-mated for each possible pair of mating clones, for individual clones acting as males and/orfemales, and finally for the ... was done following par-titioning variance and covariance componentsobtained from a one-way ANOVA and multi-variate analysis of variance (MANOVA) of pollen and seed cone ... in a sector and the value wassummed across the three levels (Muona andHaiju, 1989; Savolainen et al, 1993). The varia-tion of male flowering (male strobili bearingshoot...

Báo cáo khoa học: " Environmental and endogenous controls on leaf- and stand-level water conductance in a Scots pine plantation Neils Sturm Barbara Köstner Wolfram a John D. " pot

... seasonal and annualchanges in conductance of a Mediter-ranean oak species subjected to a largerange in radiation, temperature and soilwater availability.Despite having gained ... dur-ing recent decades of the primary factorsinfluencing stomatal conductance in nat-ural habitats, surveys demonstrate thatlarge unexplained regional and continen-tal scale ... cavitation damage in most years. Transpiration potential of the stand was reducedby thinning during autumn 1993 in approximate proportion to changes in leaf area index...

Báo cáo khoa học: "Intra-fraction setup variability: IR optical localization vs. X-ray imaging in a hypofractionated patient population" doc

... errorsand the capabilities to evaluate the need for re-planning, in the framework of and Adaptive Radiotherapy (ART)approach [10]. Along with inter-fraction variations,intra-fraction uncertainties ... analyzed data coming from 87 patients treated with hypo-fractionated radiothe rapy atcranial and extra-cranial sites. Patient setup was realized through the ExacTrac X-ray 6D system (BrainLAB,Germany), ... variability: IR opticallocalization vs. X-ray imaging in a hypofractionated patient populationMaria Francesca Spadea1,2*, Barbara Tagaste3, Marco Riboldi2,3, Eleonora Preve4, Daniela...

Báo cáo khoa học: GCN4 enhances the stability of the pore domain of potassium channel KcsA potx

... cleavage site were synthesized with a singlesynthetic oligonucleotide having the sequence: 5¢-GAAAACCTGTATTTTCAGGGCGGCACCCGCATGAAACAGATTGAGATAAACTGGAAGAAATTCTGAGCAAACTGTATCATATTGAAAACGAACTGGCGCGCATTAAAAAACTGCTGGGCGAACGC-3¢ ... cyclic-nucleotide-sensing modulator[38,39]; and the T1 domain of Shaker channel serves as a dock for auxiliary protein (i.e. an anchor for allo-cation to axonal locations as well as a modulator of gating activity) ... association of C-terminal tetrameriza-tion domains increases the local concentration of KcsA monomers,thus enhancing the rate of pore domain assembly. Right: poredomains ﬁnally associate and...

Tài liệu Báo cáo khoa học: Casein kinase 2 speciﬁcally binds to and phosphorylates the carboxy termini of ENaC subunits ppt

... phosphorylation of bENaC, oocytes were injected with a cRNA mixturecontaining a, c, and a hemagglutinin A (HA)-taggedbENaC. The HA epitope was introduced in the ectodomain at a position shown before ... several serines and threonines on the Ctermini of b and c weremutatedtoalanineandexamined for phosphorylation by fraction 76. In b the majorphosphorylated residue was S631 and mutating it to alanineblocked ... phosphorylated for 40 min by humanrecombinant CK2. The amount of phosphate incorporated wasdetermined by phosphorimaging (V) and the protein content of the radioactive band (S) was estimated. A Lineweaver–Burk...

Báo cáo khoa học: "Who, What, When, Where, Why? Comparing Multiple Approaches to the Cross-Lingual 5W Task" pptx

... Association for Computational Linguistics (ACL-02), Philadelphia, PA, USA. Mary Harper and Zhongqiang Huang. 2009. Chinese Statistical Parsing, chapter to appear. Aria Haghighi, Kristina Toutanova, ... get at the understandability of the MT output, rather than just n-gram overlap. Translation exacerbates the problem of auto-matically evaluating 5W systems. Since transla-tion introduces paraphrase, ... Cross-Lingual 5W Task In the cross-lingual 5W task, a system is given a sentence in the source language and asked to produce the 5W’s in the target language. In this task, both machine translation...

Báo cáo khoa học: Super life – how and why ‘cell selection’ leads to the fastest-growing eukaryote doc

... by the transport capacity of a given perme-ase, an increase in the surface-to-volume ratio (s ⁄ v)could allow insertion of additional permeases. Thiscould increase the uptake capacity for all ... result of in spontaneous mutations at normal rates may well havebeen the cause of the increase in lmaxduring the long-term pH-auxostat cultivations. Based on our calcula-tions of genetic variability ... the sudden increase in dilution rate, the average cell size(measured as relative cell diameter) increased in par-allel with the increase in cellular growth rate. The increase was accompanied by...

Báo cáo khóa học: Mycoplasma pneumoniae HPr kinase/phosphorylase Assigning functional roles to the P-loop and the HPr kinase/phosphorylase signature sequence motif doc

... an hour (data not shown), indicating that the proteinwas sufﬁciently stable for analysis of ATP binding. HPrK/P(F200W) was incubated with increasing concentrations of ATP, and the changes in ... eachsingle titration step, f0before addition of any ligand, andffat the end of the titration. Fitting of the curveswas performed using the GRAPHPAD PRISMsoftware(GraphPad Software, Inc.) ... the mutant G15 4A is still active as a kinase, suggesting that itcan bind ATP. Indeed, the Kd of this mutant protein for ATP was increased about eightfold, which may explain the reduced kinase activity....

Xem thêm