báo cáo khoa học: "Ectopic thymoma presenting as a giant intrathoracic tumor: A case report" ppt

... Tokusashi 2 , Naoyuki Miyokawa 2 and Tadahiro Sasajima 1 Abstract Ectopic thymoma rarely presents as an intrathoracic tumor. We report a case of ectopic thymoma presenting as a giant right intrathoracic ... 9:66 http://www.wjso.com/content/9/1/66 Page 3 of 4 CAS E REP O R T Open Access Ectopic thymoma presenting as a giant intrathoracic tumor: A case re...

Ngày tải lên: 09/08/2014, 02:20

... citation purposes) 29. Papagiannis A, Zarogoulidis K, Delis D, Patakas D: A 52-year-old man with a lung mass and acute abdominal pain. Chest 2000, 117:894-896. 30. Sakar A, Kara E, Aydede H, Ayhan ... known to metastasize to the pancreas with several case reports found in the literature, however, most patients are at an advanced stage and receive palliative treatment. Case presentat...

Ngày tải lên: 09/08/2014, 07:22

... 28:811–840. Marilyn Walker, Amanda Stent, Franc¸ois Mairesse, and Rashmi Prasad. 2007. Individual and domain adap- tation in sentence planning for dialogue. Journal of Artificial Intelligence Research (JAIR), ... problem of planning how to generate an utterance falls nat- urally into the class of statistical planning prob- lems, rather than rule-based approaches such as (Moore et al., 2004;...

Ngày tải lên: 08/03/2014, 21:20

... transfusion: case report Amreeta Dhanoa 1* , Vivek A Singh 2 , Rukmanikanthan Shanmugam 2 , Raja Rajendram 3 Abstract We describe an unusual case of osteosarcoma in a Jehovah’s Witness patient who ... University Sunway Campus, Malaysia. 2 Department of Orthopaedic Surgery, University Malaya Medical Center, Malaysia. 3 Department of Anaesthesia, University Malaya Medical Center, Malays...

Ngày tải lên: 09/08/2014, 03:22

... the described case, at first an infra- renal metastasis or an adrenal and extra-adrenal liposar- coma was assumed. Histologically, extra adrenal myelolipomas can be readily differentiated from other ... an unusual case of a myelolipoma of the adrenal gland in association with an extra-adrenal myelolipoma. This case sensitises the importance of this combination as a pitfall in the c...

Ngày tải lên: 09/08/2014, 07:21

... clinical and pathological aspects of this case are reviewed as well as the related literature. Case presentation A 50-year-old man presented with a 4-week history of rec- tal bleeding with associated ... tumours, leiomyosarcomas and gastric or intestinal adenocarcino- mas. There has been one case of intraductal papillary mucinous adenoma arising from ectopic pancreatic tissue in...

Ngày tải lên: 09/08/2014, 04:21

... The diagnosis of MS was based on clinical history, neurological examination and supported by cerebrospinal fluid analysis and Magnetic Resonance Imaging of the brain in each case. Two patients ... tilt table testing occur as a result of AD in patients with MS (12-16). On cardiovascular reflex testing it has been shown that both sympathetic as well as parasympathetic dys- functi...

Ngày tải lên: 26/10/2012, 09:39

... plasma membrane, which is also required for NADPH activation [9,10]. Once NADPH oxidase is activated, it generates H 2 O 2 , which can func- tion to kill intracellular bacteria and play pro-apopto- tic ... with pre-equilibrated Ni ⁄ nitrilotriacetate ⁄ agarose (Qiagen, Valen- cia, CA, USA), and rocked at 4 °C for 1 h. The lysate ⁄ Ni ⁄ nitrilotriacetate bead mixture was transferred to a pol...

Ngày tải lên: 20/02/2014, 01:20

... Sequence TC4 CGGTCCTATTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTTCTAGG TC6 CGGTCCTAGTTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTACTAGG TC8 CGGTCCTAGTACTCGACGCTAGCTTTTTTTTCTCTTTCCTCCTTTTCTTTTCACGTGGAGCTGTACTAGG TC10 CGGTCCTAGTACGCTCGACGCTAGCAAAATTTTCTCTTTCCTCCTTTTCAAAACACGTGGAGCTGCGTACTAGG TG6 CGGTCCTAGTTCGACGCTAGCAAAAGTTTTGGTGGTTTGTGTTTTAAAACACGTGGAGCTACTAGG TG8 CGGTCCTAGTACTC...

Ngày tải lên: 20/02/2014, 03:20

... and e,x, y available e prop a x a y cafeteria x sauna y and e,x,y available e prop ϕ 1 ϕ 2 Figure 7: An MRS for A sauna and a cafeteria are available” (top) and two of sixteen merging config- urations (below). a x a y cafeteria x sauna y and e,x,y available e prop Figure ... intensional expressions (e. g., “Is it?” or “I suppose”). Ill- available e , a x a y cafeteria x sauna y...

Ngày tải lên: 20/02/2014, 15:21