báo cáo khoa học: "Pulmonary sclerosing hemangioma in a 21-year-old male with metastatic hereditary non-polyposis colorectal cancer: Report of a case" pps

báo cáo khoa học: "Pulmonary sclerosing hemangioma in a 21-year-old male with metastatic hereditary non-polyposis colorectal cancer: Report of a case" pps

báo cáo khoa học: "Pulmonary sclerosing hemangioma in a 21-year-old male with metastatic hereditary non-polyposis colorectal cancer: Report of a case" pps

... sweats. Physical examination was unremarkable. Carcinoembryonic antigen (CEA) and carbohydrate antigen 19-9 (CA 19-9) were within nor- mal range. Clinical staging diagnostics revealed a par- tially ... 9:62 http://www.wjso.com/content/9/1/62 Page 3 of 6 CAS E REP O R T Open Access Pulmonary sclerosing hemangioma in a 21-year- old male with metastatic hereditary non- polypo...

Ngày tải lên: 09/08/2014, 01:25

6 285 0
Báo cáo khoa học: Two CYP17 genes in the South African Angora goat (Capra hircus) – the identification of three genotypes that differ in copy number and steroidogenic output pptx

Báo cáo khoa học: Two CYP17 genes in the South African Angora goat (Capra hircus) – the identification of three genotypes that differ in copy number and steroidogenic output pptx

... K, Yasuda K, Yanase T, Yamakita N, Sasano H, Nawata H, Inoue M, Fukaya T & Shizuta Y (1996) Mutation of cytochrome P-4501 7a gene (CYP17) in a Japanese patient previously reported as having ... same flock. Each group of 10 contained five ewes and five rams. The animals were all born during the same kidding season, and were approximately 14 months of age. A single dose of insul...

Ngày tải lên: 07/03/2014, 06:20

10 549 0
Báo cáo khoa học: "Enhancing Language Models in Statistical Machine Translation with Backward N-grams and Mutual Information Triggers" ppt

Báo cáo khoa học: "Enhancing Language Models in Statistical Machine Translation with Backward N-grams and Mutual Information Triggers" ppt

... statistical machine translation. In Proceed- ings of AMTA. Sylvain Raybaud, Caroline Lavecchia, David Langlois, and Kamel Sma ¨ ıli. 2009. New confidence measures for statistical machine translation. ... 2007. Large language mod- els in machine translation. In Proceedings of the 2007 Joint Conference on Empirical Methods in Nat- ural Language Processing and Computational Natu- ral...

Ngày tải lên: 07/03/2014, 22:20

10 415 0
Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt

Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt

... used to generate the mutations were (positions of mismatches underlined): F14 4A: 5¢-CAA AAT GGG GCT GAC AAC TCC-3¢; F144Y: 5¢-CAA AAT GGG TAT GAC AAC TCC-3¢; F22 9A: 5¢-CAC GAT GCT GCC CAA GTC TTT-3¢; ... subfamilies [15]. The stacking of aromatic residues against the hydrophobic faces of sugar rings is a recurring feature of protein–carbohy- drate interactions [16] and is a crit...

Ngày tải lên: 15/03/2014, 23:20

13 498 0
Báo cáo khoa học: Prohibitin is expressed in pancreatic b-cells and protects against oxidative and proapoptotic effects of ethanol pdf

Báo cáo khoa học: Prohibitin is expressed in pancreatic b-cells and protects against oxidative and proapoptotic effects of ethanol pdf

... is a pool of three target-specific 19–25 nucleo- tide siRNAs with the following sequences: 360 CAGCTTCCTCGTATCTACATTCAAGAGATG TAGATACGAGGAAGCTGTTTTT; 1179 CCATTCTGCCGTATATTGATTCAAGAGA TCAATATACGGCAGAATGGTTTTT; 1624 CTCAGAGATTGCCCTTTCTTTCAAGAGA AGAAAGGGCAATCTCTGAGTTTTT. The ... (Burlington, Canada). Ethanol was obtained from the Pharmaceutical Services of the Health Sciences Centre (Win...

Ngày tải lên: 29/03/2014, 08:20

13 447 0
Báo cáo khoa học: "Depression and anxiety in epilepsy: the association with demographic and seizure-related variables" ppt

Báo cáo khoa học: "Depression and anxiety in epilepsy: the association with demographic and seizure-related variables" ppt

... studies. With regard to depression, Boylan et al [30] reported that 50% of inpa- Table 4: Simple linear regression analyses of factors associated with STAI-S 95% Confidence interval Factor Unstandardized ... board. All participants were previously subjected to a thorough clinical and laboratory investigation, including electroen- cephalogram (EEG) and high-resolution brain magnetic...

Ngày tải lên: 08/08/2014, 23:20

8 290 0
Báo cáo khoa học: " Accelerated high-dose radiotherapy alone or combined with either concomitant or sequential chemotherapy; treatments of choice in patients with Non-Small Cell Lung Cancer" pps

Báo cáo khoa học: " Accelerated high-dose radiotherapy alone or combined with either concomitant or sequential chemotherapy; treatments of choice in patients with Non-Small Cell Lung Cancer" pps

... Schuster-Uitterhoeve AL, Vaart , Schaake-Koning CC, Benraadt J, Koolen MG, Gonzalez GD, Bartelink H: Feasibility of escalating daily doses of cisplatin in combination with accelerated radi- otherapy in non-small ... A randomised phase III study of accel- erated or standard fraction radiotherapy with or without concurrent carboplatin in inoperable non-small cell lung can- cer...

Ngày tải lên: 09/08/2014, 10:21

10 336 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

... understand- ing provides insight into potential errors (bias and random error) related to data based on clinical examina- Acta Veterinaria Scandinavica 2009, 51:36 http://www.actavetscand.com/content/51/1/36 Page ... central to minimizing variation and bias, regardless of the later use of the data for quantitative analyses. Definitions of accuracy and pre- cision here are defined in a...

Ngày tải lên: 25/10/2012, 10:45

10 588 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a ... Purification and characterization of a transmembrane domain-deleted form of lecithin retinol acyltransferase. Biochemistry 42, 6090–6098. 45 Muniz A, Vi...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

... decreases of dopamine transporter in combination with monoamine oxidase inhibition appear to have the potential of efficiently increasing extracellular dopamine levels at the same time as minimizing ... level is a key regulator of the rate of mitochondrial respiration in the heart allowing ATP and creatine phosphate levels to maintain relatively constant over a large range o...

Ngày tải lên: 14/02/2014, 14:20

91 733 0
w