báo cáo khoa học: "Case of an unusual clinical and radiological presentation of pulmonary metastasis from a costal chondrosarcoma after wide surgical resection: A transbronchial biopsy is recommended" ppt
báo cáo khoa học: "Case of an unusual clinical and radiological presentation of pulmonary metastasis from a costal chondrosarcoma after wide surgical resection: A transbronchial biopsy is recommended" ppt
... this article as: Emori et al.: Case of an unusual clinical and radiological presentation of pulmonary metastasis from a costal chondrosarcoma after wide surgical resection: A transbro nchial biopsy is ... SURGICAL ONCOLOGY Case of an unusual clinical and radiological presentation of pulmonary metastasis from a costal chon...
Ngày tải lên: 09/08/2014, 01:24
Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx
... agammaglobulin- emia. A clinical and molecular analysis. Medicine (Baltimore) 75, 287–299. 27 Plebani A, Soresina A, Rondelli R, Amato GM, Azzari C, Cardinale F, Cazzola G, Consolini R, De Mattia D, Dell’Erba G ... Tsukada S, Saffran DC, Rawlings DJ, Parolini O, Allen RC, Klisak I, Sparkes RS, Kubagawa H, Mohandas T, Quan S et al. (1993) Deficient expression of a B cell cytoplasmic...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: Competition between innate multidrug resistance and intracellular binding of rhodamine dyes pdf
... centrifugation through an oil cushion and dissolved prior to determination of the amount of dyes associated with them. The advantages of such an assay are that: (a) it is quantitative; (b) it is not affected ... Doyle LA, Yang W, Abruzzo LV, Krogmann T, Gao Y, Rishi AK & Ross DD (1998) A multidrug resistance transporter from human MCF-7 breast cancer cells [Published e...
Ngày tải lên: 18/02/2014, 13:20
Báo cáo khoa học: Human telomeric G-quadruplex: thermodynamic and kinetic studies of telomeric quadruplex stability potx
... quadruplex folding and unfolding reac- tions, with the significant advantage that enthalpy changes can be monitored directly and data obtained in a model-free fashion [36,37]. Disadvantages of ... and stability. In Quadruplex Nucleic Acids (Neidle S & Balasubramanian S, eds), pp. 100–130. Royal Society of Chemistry, Cambridge. 67 Nakatani K, Hagihara S, Sando S, Sakamoto S, Yam...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
... °C CACCTCGAGTTATTATAGCTCAAACACCATCC 44/587 AAACTCGAGAGATCTAAATCCTCCAATGAAGC 30 s/94 °C; 1 min/56 °C; 3 min/72 °C CACCTCGAGTTATTATAGCTCAAACACCATCC 44/750_V5-His AAACTCGAGAGATCTAAATCCTCCAATGAAGC ... min/72 °C AAACTCGAGTTATTATTCAATATCAAACAGAG 59/750 AAAAGATCTAAAGCATTTTTGGATGAATTG 1 min/94 °C; 1 min/54 °C; 4 min/72 °C ATTCTCGAGTCATTAGGCTACTTCACTCAAAG 90/750 AAAAGATCTTTTCAGCTTGCAAAGCAA 1 min/94 °C...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Residues affecting the chloride regulation and substrate selectivity of the angiotensin-converting enzymes (ACE and ACE2) identified by site-directed mutagenesis pot
... mM (filled bars) NaCl. (A) Cleavage of angiotensin I by tACE variants. (B) Cleavage of angiotensin I by ACE2 variants. (C) Cleavage of angio- tensin II by ACE2 variants. Generation of product was determined by ... that this variant has a threefold greater catalytic efficiency than the wild-type with angiotensin II, and this is not a result of an alteration in substrate-bindi...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: Purification, characterization, cDNA cloning and nucleotide sequencing of a cellulase from the yellow-spotted longicorn beetle, Psacothea hilaris ppt
... cellotetraose Fig. 1. SDS/PAGE analysis of the purified cellulase from larval gut juice of P. hilaris . Lane 1, molecular mass standards consisting of myosin (200 kDa), b-galactosidase (116 kDa), phosphorylase ... G., Saito, H. & Watanabe, H. (2002) A digestive beta- glucosidase from the salivary glands of the termite, Neotermes koshunensis (Shiraki): distribution, characteri...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: Structural insight into the evolutionary and pharmacologic homology of glutamate carboxypeptidases II and III ppt
... (such as macaque, mouse and rat). Ramachandran analysis of the final models classifies all residues but two, Lys197 and Asn168 (in the GCPIII ⁄ ‘pseudo-unliganded’ complex only), as having either favorable ... struc- tural domains, which are analogous to the three domains of GCPII [27]: a protease domain (amino acids 46–106 and 342–580), an apical domain (amino acids 107–341) and...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khoa học: Tec family kinases: Itk signaling and the development of NKT ab and cd T cells potx
... Beach D & Yablonski D (2007) SLP-76 mediates and maintains activation of the Tec family kinase ITK via the T cell antigen receptor- induced association between SLP-76 and ITK. Proc Natl Acad ... 111–119. 23 Townsend M, Weinmann A, Matsuda J, Salomon R, Farnham P, Biron C, Gapin L & Glimcher L (2004) T-bet regulates the terminal maturation and homeostasis of NK and Valpha1...
Ngày tải lên: 28/03/2014, 22:21
Báo cáo khoa học: " Risk factors for retained placenta and the effect of retained placenta on the occurrence of postpartum diseases and subsequent reproductive performance in dairy cows" potx
... observed by the veterinarian and/ or farmer within 4 weeks postpartum. Abomasal displacement was diagnosed by a pinging sound upon abdominal auscultation by a veterinarian, and all cases were corrected ... present: an ovarian structure of greater than 25 mm internal diameter with a wall less than 3 mm thick (follicular cyst) and with a wall more than 3 mm thick (luteal cyst)...
Ngày tải lên: 07/08/2014, 18:21