báo cáo khoa học: "Spontaneous intraperitoneal rupture of pyonephrosis in a patient with unknown kidney carcinosarcoma: a case report" ppt

... 9:39http://www.wjso.com/content/9/1/39Page 2 of 4CAS E REP O R T Open AccessSpontaneous intraperitoneal rupture of pyonephrosis in a patient with unknown kidney carcinosarcoma: a case reportSilvia Quaresima, Antonio Manzelli, ... laparotomy [3].The aim of this paper is to present an unusual case of a 68 years old man, with a previous history of gallstone pyonephrosis, presenting with an acute abdomen andhaving a final ... was later found to have a carcinosarcoma of the kidney. The case highlights theimportance of recognizing the possibility of underling renal carcinoma in patients presenting with a rupturedpyonephrosis...

Tài liệu Báo cáo khoa học: Post-translational cleavage of recombinantly expressed nitrilase from Rhodococcus rhodochrous J1 yields a stable, active helical form ppt

... Yamamoto M,Kumasaka T, Ueki T, Nanba H, Ikenaka Y, TakahashiS, Sato M et al. (2000) Crystal structure of N-carbamyl-d-amino acid amidohydrolase with a novel catalyticframework common to amidohydrolases. ... SDS ⁄ PAGE of the active fraction showed a characteristic nitrilase band of  40 kDa. The contaminating band at60 kDa was identiﬁed as GroEL on the basis of its characteristic appearance in the ... corresponding carboxylic acids andammonia. They belong to a superfamily [1] thatincludes amidases, acyl transferases and N-carbamoyl-d-amino acid amidohydrolases, and they occur in bothprokaryotes...

Tài liệu Báo cáo khoa học: N-terminal extension of the yeast IA3 aspartic proteinase inhibitor relaxes the strict intrinsic selectivity ppt

... CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCC16 (F) GGAATTCCATATGCAGAATACAGACCAACAAAAAGTGAG(R) CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCCnewpetTOP CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATAAGCTTATGAAACACCACCACCACCACCACCAnewpetBOT ... CCGCTCGAGATGATCCATCAATTCATCTTTATCTTG5 (F) GGAATTCCATATGAGTGATAAAAACGCTAACGTC(R) CTAGCTAGCCATGTTTTTCATTCCTTCACTAGC11 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT(R) CCGCTCGAGCGGCTATCTATCTAATGATCCATCAATTCATCTTTATC12 ... CCGCTCGAGCGGCTATCTATCTAATGATCCATCAATTCATCTTTATC12 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT(R) CCGCTCGAGCGGCTATCTATCTATTGTTCTTGCTTCCCAGCACC13 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT(R) CCGCTCGAGCGGCTATCTATCTAATACGAATCTTGAGCTTTCTTTTC14...

Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

... I,Strauss A et al. (1997) Biochemical characterization of puriﬁed, human recombinant Lys304?Glu medium-chainacyl-CoA dehydrogenase containing the common dis-ease-causing mutation and comparison with ... normalenzyme. Eur J Biochem 246, 548–556.15 Ikeda Y, Okamura-Ikeda K & Tanaka K (1985) Puriﬁ-cation and characterization of short-chain, medium-chain, and long-chain acyl-CoA dehydrogenases ... bybiochemical testing, the actual outcome can vary fromindividual to individual depending on the functionaloverlap of VLCAD, LCAD, MCAD and SCAD, theefﬁciency of the chaperonin-aided folding, the...

Tài liệu Báo cáo khoa học: "An Empirical Investigation of Discounting in Cross-Domain Language Models" ppt

... (Paul) Hsu and James Glass. 2008. N-gram Weighting: Reducing Training Data Mismatch in Cross-Domain Language Model Estimation. In Pro-ceedings of the Conference on Empirical Methods in Natural ... thenumber of bigram types in the train and test corpora,which can be as large as 10%: observing more bi-gram contexts in training fragments the token counts2One could also imagine instead canonicalizing ... Gigaword for the year 1995. In order to create two corpora that are maximallydomain-similar, we randomly assign half of thesedocuments to train and half of them to test, yieldingtrain and...

Tài liệu Báo cáo khoa học: "An Empirical Investigation of Proposals in Collaborative Dialogues" docx

... two participants collaborate on a simple task of buying furniture for the living and dining rooms of a house (a variant of the task in (Walker, 1993)). The participants' main goal is ... Thomason and Jerry R. Hobbs. 1997. Interrelating interpretation and generation in an abductive framework. AAAI Fall Symposium on Communicative Actions in Human and Machines, Cambridge MA. Raimo ... must have a solution. For exam- ple, if 5 instances of sofas are known for varsola, but every assignment of a value to varsoIa violates the budget constraint, then varsola and the constraint...

Báo cáo khoa học: Alternative splicing: role of pseudoexons in human disease and potential therapeutic strategies pot

... 974–980.88 Faa`V, Incani F, Meloni A, Corda D, Masala M,Bafﬁco AM, Seia M, Cao A & Rosatelli MC. (2009).Characterization of a disease-associated mutation affect-ing a putative splicing regulatory ... of a mutation. Proc Natl Acad Sci USA80, 1184–1188.82 Cheng TC, Orkin SH, Antonarakis SE, Potter MJ,Sexton JP, Markham AF, Giardina PJ, Li A &Kazazian HH Jr. (1984) Beta-thalassemia in ... Garcia-Blanco MA (2005) Making antisense of splicing. Curr Opin Mol Ther 7, 476–482.78 Ishii S, Nakao S, Minamikawa-Tachino R, Desnick RJ& Fan JQ (2002) Alternative splicing in the alpha-galactosidase...

Báo cáo khoa học: "Corpus-based interpretation of instructions in virtual environments" pot

... 2004.Automated Planning: Theory & Practice. MorganKaufmann Publishers Inc., California, USA.Masoud Nikravesh, Tomohiro Takagi, Masanori Tajima,Akiyoshi Shinmura, Ryosuke Ohgaya, Koji Taniguchi,Kazuyosi ... Taniguchi,Kazuyosi Kawahara, Kouta Fukano, and AkikoAizawa. 2005. Soft computing for perception-baseddecision processing and analysis: Web-based BISC-DSS. In Masoud Nikravesh, Lotﬁ Zadeh, and JanuszKacprzyk, ... formapping instructions to actions. In Proceedings of the Joint Conference of the 47th Annual Meeting of the ACL and the 4th International Joint Conferenceon Natural Language Processing of the AFNLP,...

Báo cáo khoa học: Modeling hydration mechanisms of enzymes in nonpolar and polar organic solvents potx

... such as ethanol andacetonitrile. This may be because only a small amount of water is retained at the enzyme surface in the case of polar organic solvents relative to nonpolar organicsolvents, as ... wateris only weakly retained. In the particular case of hexane, most of the wateris located in this ﬁrst hydration shell around theenzyme, covering a large proportion of the surfacearea of the enzyme ... Carlsberg formed in anhydrousacetonitrile and in water. Proc Natl Acad Sci USA 95,12918–12923.33 Yennawar NH, Yennawar HP & Farber GK (1994)X-ray crystal-structure of gamma-chymotrypsin...

Báo cáo khoa học: "Identifying Syntactic Role of Antecedent in Korean Relative Clause Using Corpus and Thesaurus Information" pdf

... the case particle of an antecedent, that indicates the syntactic role in the relative clause, is omitted during relativization. In fact, in a relatively free-word order language, the case particles ... describes an approach to identify- ing the syntactic role of an antecedent in a Ko- rean relative clause, which is essential to struc- tural disambiguation and semantic analysis. In a learning phase, ... codes at level 4 of the Kadokawa thesaurus. A nominal word may have multi- ple meanings such as C1,C2, , Cn. However, since we cannot determine which meaning of the nominal word is used in a...

Xem thêm