báo cáo khoa học: "Spontaneous intraperitoneal rupture of pyonephrosis in a patient with unknown kidney carcinosarcoma: a case report" ppt

... 9:39 http://www.wjso.com/content/9/1/39 Page 2 of 4 CAS E REP O R T Open Access Spontaneous intraperitoneal rupture of pyonephrosis in a patient with unknown kidney carcinosarcoma: a case report Silvia Quaresima, Antonio Manzelli, ... laparotomy [3]. The aim of this paper is to present an unusual case of a 68 years old man, with a previous history of...

Ngày tải lên: 09/08/2014, 01:24

... Yamamoto M, Kumasaka T, Ueki T, Nanba H, Ikenaka Y, Takahashi S, Sato M et al. (2000) Crystal structure of N-carbamyl- d-amino acid amidohydrolase with a novel catalytic framework common to amidohydrolases. ... SDS ⁄ PAGE of the active fraction showed a characteristic nitrilase band of  40 kDa. The contaminating band at 60 kDa was identified as GroEL on the basis of its characte...

Ngày tải lên: 19/02/2014, 00:20

... CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCC 16 (F) GGAATTCCATATGCAGAATACAGACCAACAAAAAGTGAG (R) CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCC newpetTOP CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATAAGCTTATGAAACACCACCACCACCACCACCA newpetBOT ... CCGCTCGAGATGATCCATCAATTCATCTTTATCTTG 5 (F) GGAATTCCATATGAGTGATAAAAACGCTAACGTC (R) CTAGCTAGCCATGTTTTTCATTCCTTCACTAGC 11 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT (R)...

Ngày tải lên: 19/02/2014, 00:20

... I, Strauss A et al. (1997) Biochemical characterization of purified, human recombinant Lys304?Glu medium-chain acyl-CoA dehydrogenase containing the common dis- ease-causing mutation and comparison with ... normal enzyme. Eur J Biochem 246, 548–556. 15 Ikeda Y, Okamura-Ikeda K & Tanaka K (1985) Purifi- cation and characterization of short-chain, medium- chain, and long-chain acyl-Co...

Ngày tải lên: 20/02/2014, 02:21

... (Paul) Hsu and James Glass. 2008. N- gram Weighting: Reducing Training Data Mismatch in Cross-Domain Language Model Estimation. In Pro- ceedings of the Conference on Empirical Methods in Natural ... the number of bigram types in the train and test corpora, which can be as large as 10%: observing more bi- gram contexts in training fragments the token counts 2 One could also imagi...

Ngày tải lên: 20/02/2014, 04:20

... two participants collaborate on a simple task of buying furniture for the living and dining rooms of a house (a variant of the task in (Walker, 1993)). The participants' main goal is ... Thomason and Jerry R. Hobbs. 1997. Interrelating interpretation and generation in an abductive framework. AAAI Fall Symposium on Communicative Actions in Human and Machines, Cambri...

Ngày tải lên: 20/02/2014, 18:20

... 974–980. 88 Faa ` V, Incani F, Meloni A, Corda D, Masala M, Baffico AM, Seia M, Cao A & Rosatelli MC. (2009). Characterization of a disease-associated mutation affect- ing a putative splicing regulatory ... of a mutation. Proc Natl Acad Sci USA 80, 1184–1188. 82 Cheng TC, Orkin SH, Antonarakis SE, Potter MJ, Sexton JP, Markham AF, Giardina PJ, Li A & Kazazian HH Jr. (198...

Ngày tải lên: 06/03/2014, 09:22

... 2004. Automated Planning: Theory & Practice. Morgan Kaufmann Publishers Inc., California, USA. Masoud Nikravesh, Tomohiro Takagi, Masanori Tajima, Akiyoshi Shinmura, Ryosuke Ohgaya, Koji Taniguchi, Kazuyosi ... Taniguchi, Kazuyosi Kawahara, Kouta Fukano, and Akiko Aizawa. 2005. Soft computing for perception-based decision processing and analysis: Web-based BISC- DSS. In Masoud Nikravesh...

Ngày tải lên: 07/03/2014, 18:20

... such as ethanol and acetonitrile. This may be because only a small amount of water is retained at the enzyme surface in the case of polar organic solvents relative to nonpolar organic solvents, as ... water is only weakly retained. In the particular case of hexane, most of the water is located in this first hydration shell around the enzyme, covering a large proportion o...

Ngày tải lên: 16/03/2014, 10:20

... the case particle of an antecedent, that indicates the syntactic role in the relative clause, is omitted during relativization. In fact, in a relatively free-word order language, the case particles ... describes an approach to identify- ing the syntactic role of an antecedent in a Ko- rean relative clause, which is essential to struc- tural disambiguation and semanti...

Ngày tải lên: 17/03/2014, 07:20