báo cáo khoa học: "Case report of rapidly progressive proliferative verrucous leukoplakia and a proposal for aetiology in mainland China" pps

báo cáo khoa học: "Case report of rapidly progressive proliferative verrucous leukoplakia and a proposal for aetiology in mainland China" pps

báo cáo khoa học: "Case report of rapidly progressive proliferative verrucous leukoplakia and a proposal for aetiology in mainland China" pps

... 21(4):164-170. doi:10.1186/1477-7819-9-26 Cite this article as: Ge et al.: Case report of rapidly progressive proliferative verrucous leukoplakia and a proposal for aetiology in mainland China. World Journal of Surgical Oncology 2011 ... repair with skin grafting. The wound healed well after surgery. A histological examination revealed that the palatal carcinom...

Ngày tải lên: 09/08/2014, 01:24

4 258 0
Báo cáo khoa học: "Neuromesenchymal hamartoma of small bowel - an extremely rare entity: a case report" doc

Báo cáo khoa học: "Neuromesenchymal hamartoma of small bowel - an extremely rare entity: a case report" doc

... Neuromuscular and vascular hamartoma of small bowel presenting as inflammatory bowel disease. Gut 1986, 27(8):964-9. 5. Fernando SSE, McGovern VJ: Neuromuscular and vascular hamartoma of small bowel. ... Neu- romesenchymal hamartoma of the small bowel. Consent Written informed consent was obtained from the patient for publication of this case report and accompanying images....

Ngày tải lên: 09/08/2014, 04:21

4 284 0
Báo cáo khoa học: " Neoadjuvant radiotherapy of primary irresectable unicentric Castleman’s disease: a case report and review of the literature" pps

Báo cáo khoa học: " Neoadjuvant radiotherapy of primary irresectable unicentric Castleman’s disease: a case report and review of the literature" pps

... Radiotherapy, Catharina Hospital, Eindhoven, The Netherlands. Authors’ contributions IAC, MMS, GAP have made substantial contributions to conception and design, and acquisition of data and analysis and ... etiology of this disorder is unclear, although the histopathological presentation can be differentiated into a hyaline vascular variant, a plasma cell variant and a mixe...

Ngày tải lên: 09/08/2014, 10:20

5 436 0
Báo cáo khoa học: "Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study" potx

Báo cáo khoa học: "Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study" potx

... ACL and AFNLP Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging – A Case Study Wenbin Jiang † Liang Huang ‡ Qun Liu † † Key Lab. of Intelligent Information ... Frustratingly easy domain adap- tation. In Proceedings of ACL. Jianfeng Gao, Andi Wu, Mu Li, Chang-Ning Huang, Hongqiao Li, Xinsong Xia, and Haowei Qin. 2004. Adaptive chinese word...

Ngày tải lên: 17/03/2014, 01:20

9 404 0
Báo cáo khoa học: "mproving models of wood density by including genetic effects: A case study in Douglas-fir" potx

Báo cáo khoa học: "mproving models of wood density by including genetic effects: A case study in Douglas-fir" potx

... A genetic effect may affect the significance level of a model in at least two ways: either as a main factor, as in analysis of vari- ance (ANOVA), or within an interaction term when asso- ciated ... the interaction between ring width and provenance (table IV), and the interaction between ring width and ring cambial age for provenances (table IV) and clones (table VI)....

Ngày tải lên: 08/08/2014, 14:21

10 336 0
Báo cáo khoa học: "Toxicity report of once weekly radiation therapy for low-risk prostate adenocarcinoma: preliminary results of a phase I/II trial" pdf

Báo cáo khoa học: "Toxicity report of once weekly radiation therapy for low-risk prostate adenocarcinoma: preliminary results of a phase I/II trial" pdf

... month and maximal acute toxicity are shown in Table 4. Data for all and 52 patients were available for analysis at 19 and 31 months, respectively, and are shown in Table 5. Crude late grade ≥ ... Thu Van Nguyen 4 , Bernard Fortin 1 and Carole Lambert 4* Abstract Background: Increasing clinical data supports a low a/ b ratio for prostate adenocarcinoma, potentially lower...

Ngày tải lên: 09/08/2014, 09:21

8 322 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 10482 10661 179 1G4P217 Group 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 92.1 ± 0.57 73.6 ± 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT GCTA...

Ngày tải lên: 14/02/2014, 19:20

12 796 0
Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx

Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx

... Toshiko Maeta and Taka- shi Nakamura for their technical assistance. Drs Kazu- hito Naka (Kanazawa University) and Yasuo Ariumi (Okayama University) are also thanked for their valuable input in this ... that parental PH5CH cells and their clones retained both TRIF- and Cardif-mediated pathways as antiviral dsRNA signaling pathways, and confirmed that the PH5CH8 cell line was fa...

Ngày tải lên: 18/02/2014, 16:20

16 524 0
Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... 339 amino acids specifying a 40-kDa protein (AUHp40). Western blot analysis of brain extracts consistently revealed a 32 kDa AUH protein and it was thus assumed that the mature form of human AUH ... AUH in brain has a molecular weight of 32 kDa (AUHp32) [15]. For the kinetic characterization of AUH described in the work at hand, AUH was overproduced in Escherichia coli...

Ngày tải lên: 19/02/2014, 07:20

11 625 0
Tài liệu Báo cáo khoa học: ATPase activity of magnesium chelatase subunit I is required to maintain subunit D in vivo ppt

Tài liệu Báo cáo khoa học: ATPase activity of magnesium chelatase subunit I is required to maintain subunit D in vivo ppt

... the XAN-H protein affects the level of Xantha-g mRNA. Therefore, the presence of Xantha-g mRNA was analysed in one semidominant and one recessive xantha-h mutant (Xantha- h clo 157 and xantha-h 57 , ... when ADP was used instead of ATP (Fig. 4B). Presence of Xantha-g mRNA in xantha-h mutants A possible explanation for the absence of 70 kDa XAN-G protein in the xantha-h...

Ngày tải lên: 19/02/2014, 12:20

7 475 0
Từ khóa:
w