báo cáo khoa học: " A rare case of giant leiomyosarcoma in a filarial scrotum: a case report" ppt

báo cáo khoa học: "Pigmented villonodular synovitis of the hip in systemic lupus erythematosus: a case report" pptx

... consent was obtained from the patientat adult age for publication of this case report and anyaccompanying images. A copy of the written consent isavailable for review by the Editor -in- Chief of thisjournal.AcknowledgementsThe ... equally prevalent in ma les and femaleswhile SLE has a 1:9 male to female ratio, which alsoargues against a shared pathogenesis. This includes a potential role of estrogens which clearly contribute ... synovial proliferation appears in dark grey in the T2-weightedimage at the same location. Bone or cartilage did not displayerosions or thinning, respectively.Anders Journal of Medical Case Reports...

Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt

... a study of chimeric forms of DPP IV has shown that the luminaldomain of DPP IV carries dominant apical sortinginformation while the short cytoplasmic tail and thetransmembrane domain contain ... X & Zhang G (2003) Tyrosine kinaseand tyrosine phosphatase participate in regulation of interactions of NMDA receptor subunit 2A with Srcand Fyn mediated by PSD-95 after transient brainischemia. ... Protein content of fractionswas determined by a modiﬁcation of the Bradford methodusing BSA as a standard. Statistical analysis wasperformed with statview (Abacus Concepts Inc.,Berkeley, CA).Electron...

Báo cáo khoa học: "Oxcarbazepine as monotherapy of acute mania in insufficiently controlled type-1 diabetes mellitus: a case-report" pdf

... G Masdrakis1, Konstantinos A Kontoangelos1, Konstantinos Makrilakis2, Nikolaos A Karakatsanis1, Charalambos Papageorgiou1, Nikolaos Katsilambros2 and Constantin R Soldatos1Address: ... combination of an antipsy-chotic with valproate or carbamazepine, possibly with a benzodiazepine as an adjunctive medication. However, in the case of our patient, administration of lithium salts ... Masdrakis - vmasdrakis@med.uoa.gr; Konstantinos A Kontoangelos - kontangel@hol.gr; Konstantinos Makrilakis - kmakrila@yahoo.com; Nikolaos A Karakatsanis - dr_kar7@otenet.gr; Charalambos Papageorgiou...

báo cáo khoa học: "Diagnosis and management of an immature teratoma during ovarian stimulation: a case report" ppsx

... and all authors read and approved the final manuscript. Diagnosis and management of an immature teratoma during ovarian stimulation: a case report Nathalie Douay-Hauser1, Martin ... stimulation: a case reportJournal of Medical Case Reports 2011, 5:540 doi:10.1186/1752-1947-5-540Nathalie Douay-Hauser (nathalie.douay-hauser@bch.aphp.fr)Martin Koskas (martin.koskass@bch.aphp.fr)Francine ... the article as it appeared upon acceptance. Fully formattedPDF and full text (HTML) versions will be made available soon.Diagnosis and management of an immature teratoma during ovarian stimulation:a...

báo cáo khoa học: " Paget’s disease of the breast in a male with lymphomatoid papulosis: a case report" doc

... concomitantly with an underlying invasivecarcinoma, ductal carcinoma in situ or with no underly-ing breast cancer. Forty six percent of Paget’scasespre-sent without a mass and of these, underlying ... disease is an eczematous skin change of the nip-ple that is usually associated with an underlying breastmalignancy [1]. It may present with erythema, scaling,ulceration, bleeding or a painful ... G,Wickramasinghe SN, Everson RB, Ames BN: Folate deficiency causes uracilmisincorporation into human DNA and chromosome breakage:implications for cancer and neuronal damage. Proc Natl Acad Sci USA1997,...

3
1,053
0

báo cáo khoa học: " Typical carcinoid tumor of the larynx in a woman: a case report" potx

... magnification ×400).Figure 2 The lamina propria contained a tumor consisting of small trabeculae and small nests of round cells (hematoxylinand eosin, original magnification ×100).Kayhan and Başaran ... paragangliomas. Typical carcinoid tumor of the larynx is a particularly rare occurrence. We present a case of this rare disease, and review and discuss its diagnosis and treatment. Case presentation: ... this article as: Kayhan and Başaran: Typical carcinoid tumor of thelarynx in a woman: a case report. Journal of Medical Case Reports 20104:321.Submit your next manuscript to BioMed Centraland...

báo cáo khoa học: "Squamous cell carcinoma of rectum presenting in a man: a case report" potx

... cellcarcinoma 11 years after brachytherapy for carcinoma of the prostate. JUrol 2003, 169:280.20. Jaworski RC, Biankin SA, Baird PJ: Squamous cell carcinoma in situ arising in inflammatory cloacogenic ... cell carcinoma of the rectum in the ethnic Kashmiri population in northern India. Case Presentation: The case of a 60-year-old male patient (Asian) with a pure squamous cell carcinoma of therectum ... complaints of severelower-abdominal pain for the past eight months. Thepatient also complained of severe constipation, nausea,vomiting, anorexia, loss of appetite, abdominal cramps,incontinence...

Báo cáo khoa học: Phosphorylation-dependent binding of human transcription factor MOK2 to lamin A⁄C pot

... phosphory-lated and then released from lamin A ⁄ C. This regula-tion may take place following activation of kinasessuch as PKA in response to various signalingpathways. In addition, Aurora A kinase ... Ohashi S, Sakashita G, Ban R, Nagasawa M, MatsuzakiH, Murata Y, Taniguchi H, Shima H, Furukawa K &Urano T (2006) Phospho-regulation of humanprotein kinase Aurora -A: analysis using anti-phospho-Thr288 ... Yoshioka K, Akechi M, Yamashita S, Takama-tsu N, Sugiyama K, Hibi M, Nakabeppu Y, Shiba T &Yamamoto KI (1999) JSAP1, a novel jun N-terminalprotein kinase (JNK)-binding protein that functions...

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

... (1970) Cleavage of structural proteins during theassembly of the head of bacteriophage T4. Nature 227, 680–685.12. Vincentelli, R., Canaan, S., Campanacci, V., Valencia, C.,Maurin, D., Frassinetti, ... connecting strandb3 to helix a1 and two small h elices (a4 anda6).The catalytic site consists of a functional catalytic triadfound in all serine enzymes of the a/ b hydrolase fold family in which ... of a catalytic nucleophile serine,associated to a proton c arrier histidine and a c harge r elayingaspartic (or glutamic) acid. To further investigate thebiochemical characterization of the...

Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt

... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAGHC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAGMG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG3K6S7K GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCCT3 ... ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCCMG6S GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG6X GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGACMG3X ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGACXHO-TNF13 ... Yoshiyuki Kayano, Sayaka Nakao, Nagisa Sakurai,Hiroyuki Iwata1and Rumi IshisakaDepartment of Biological Chemistry and1Department of Veterinary Medicine, Faculty of Agriculture, Yamaguchi University,Yamaguchi,...

Xem thêm