... consent was obtained from the patient at adult age for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor -in- Chief of this journal. Acknowledgements The ... equally prevalent in ma les and females while SLE has a 1:9 male to female ratio, which also argues against a shared pathogenesis. This includ...
Ngày tải lên: 10/08/2014, 23:20
... a study of chimeric forms of DPP IV has shown that the luminal domain of DPP IV carries dominant apical sorting information while the short cytoplasmic tail and the transmembrane domain contain ... X & Zhang G (2003) Tyrosine kinase and tyrosine phosphatase participate in regulation of interactions of NMDA receptor subunit 2A with Src and Fyn mediated by PSD-95 after transi...
Ngày tải lên: 19/02/2014, 07:20
Báo cáo khoa học: "Oxcarbazepine as monotherapy of acute mania in insufficiently controlled type-1 diabetes mellitus: a case-report" pdf
... G Masdrakis 1 , Konstantinos A Kontoangelos 1 , Konstantinos Makrilakis 2 , Nikolaos A Karakatsanis 1 , Charalambos Papageorgiou 1 , Nikolaos Katsilambros 2 and Constantin R Soldatos 1 Address: ... combination of an antipsy- chotic with valproate or carbamazepine, possibly with a benzodiazepine as an adjunctive medication. However, in the case of our patient, administration...
Ngày tải lên: 08/08/2014, 23:20
báo cáo khoa học: "Diagnosis and management of an immature teratoma during ovarian stimulation: a case report" ppsx
... and all authors read and approved the final manuscript. Diagnosis and management of an immature teratoma during ovarian stimulation: a case report Nathalie Douay-Hauser 1 , Martin ... stimulation: a case report Journal of Medical Case Reports 2011, 5:540 doi:10.1186/1752-1947-5-540 Nathalie Douay-Hauser (nathalie.douay-hauser@bch.aphp.fr) Martin Koskas (martin.ko...
Ngày tải lên: 10/08/2014, 22:20
báo cáo khoa học: " Paget’s disease of the breast in a male with lymphomatoid papulosis: a case report" doc
... concomitantly with an underlying invasive carcinoma, ductal carcinoma in situ or with no underly- ing breast cancer. Forty six percent of Paget’scasespre- sent without a mass and of these, underlying ... disease is an eczematous skin change of the nip- ple that is usually associated with an underlying breast malignancy [1]. It may present with erythema, scaling, ulceration, bleeding...
Ngày tải lên: 11/08/2014, 00:22
báo cáo khoa học: " Typical carcinoid tumor of the larynx in a woman: a case report" potx
... magnification ×400). Figure 2 The lamina propria contained a tumor consisting of small trabeculae and small nests of round cells (hematoxylin and eosin, original magnification ×100). Kayhan and Başaran ... paragangliomas. Typical carcinoid tumor of the larynx is a particularly rare occurrence. We present a case of this rare disease, and review and discuss its diagnosis and...
Ngày tải lên: 11/08/2014, 02:21
báo cáo khoa học: "Squamous cell carcinoma of rectum presenting in a man: a case report" potx
... cell carcinoma 11 years after brachytherapy for carcinoma of the prostate. J Urol 2003, 169:280. 20. Jaworski RC, Biankin SA, Baird PJ: Squamous cell carcinoma in situ arising in inflammatory cloacogenic ... cell carcinoma of the rectum in the ethnic Kashmiri population in northern India. Case Presentation: The case of a 60-year-old male patient (Asian) with a pure squam...
Ngày tải lên: 11/08/2014, 02:22
Báo cáo khoa học: Phosphorylation-dependent binding of human transcription factor MOK2 to lamin A⁄C pot
... phosphory- lated and then released from lamin A ⁄ C. This regula- tion may take place following activation of kinases such as PKA in response to various signaling pathways. In addition, Aurora A kinase ... Ohashi S, Sakashita G, Ban R, Nagasawa M, Matsuzaki H, Murata Y, Taniguchi H, Shima H, Furukawa K & Urano T (2006) Phospho-regulation of human protein kinase Aurora -A: anal...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx
... (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. 12. Vincentelli, R., Canaan, S., Campanacci, V., Valencia, C., Maurin, D., Frassinetti, ... connecting strand b3 to helix a1 and two small h elices (a4 anda6). The catalytic site consists of a functional catalytic triad found in all serine enzymes of the a/ b hydrol...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG HC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG MG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG3K6S7K GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC T3 ... ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC MG6S GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG6X GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAG...
Ngày tải lên: 16/03/2014, 16:20