báo cáo khoa học: "Analysis of the recurrence risk factors f

báo cáo khoa học: "Analysis of the recurrence risk factors for the patients with hepatocellular carcinoma meeting University of California San Francisco criteria after curative hepatectomy" pot

... group of patients is a higher risk of recurrence than transplantation. The aims of this study were to find the recurrence risk factors for those patients with a tumor/tumors meeting UCSF criteria. ... were the risk fact ors of tumor recurrence. For the patients without or with limited risk fa ctors of tumor recurrence, hepatectomy rather than...

Ngày tải lên : 09/08/2014, 01:24

6
337
0

Báo cáo khoa học: "Most common genotypes and risk factors for HCV in Gaza strip: a cross sectional study" potx

... the genotype of the patient (P-value = 0.002). For example, 73.1% of the patients infected with type 1 had ALT values above 40 IU mL -1 . On the other hand 66% of type 4 patients, and 71.4% of ... = 13.75). Genotype and place of living The majority of the study population (63%) were from the south of Gaza Strip and 34 (37%) were from the north. The major...

Ngày tải lên : 12/08/2014, 04:22

7
439
0

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (DDDDK) was included within the forward primer immediately upstream of the start codon (ATG). Primers with the fol- lowing sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; ... l-gulono-1,4-lactone dehydrogenase of M. tuberculosis is a speciﬁc enzyme for the biosynthesi...

Ngày tải lên : 07/03/2014, 12:20

11
571
0

Báo cáo khoa học: Two short protein domains are responsible for the nuclear localization of the mouse spermine oxidase l isoform pdf

... function of SMO (e.g. nuclear targeting of the mSMOl isoform). Inspection of the mSMOl modelled structure (Fig. 2) indicates that both regions are located on the tip of the FAD-binding domain, with ... cytosolic. The only structural difference between the two isoforms is the presence of an extra protein domain in mSMO l, encoded by the exon VIa [10]. Comparative an...

Ngày tải lên : 07/03/2014, 17:20

8
413
0

Báo cáo khoa học: "TaqMan reverse transcription polymerase chain reaction for the detection of Japanese encephalitis virus" pot

... specificity for the detection of JEV in real time RT-PCR assay. We also considered the length of amplified fragment, because amplicon size was affected by hybridization of the fluorescent probe. The ... sensitivity of the newly developed method. Ten-fold serial dilutions of the extracted viral RNA from the JEV infected culture supernatants were analyzed to define th...

Ngày tải lên : 07/08/2014, 18:20

7
334
1

Báo cáo khoa học: " Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" ppsx

... interests The authors declare that they have no competing interests. Authors' contributions BS and VT participated in the design of the study, per- formed the experiments and drafted the manuscript. ... positive for the HCV E2 glycoprotein and that the entire aggregate was permissive for HCV infection rather than just the cells at the periphery, demonstrating that...

Ngày tải lên : 12/08/2014, 04:21

8
326
0

Báo cáo khoa học: "Three-dimensional Huh7 cell culture system for the study of Hepatitis C virus infection" pdf

... positive for the HCV E2 glycoprotein and that the entire aggregate was permissive for HCV infection rather than just the cells at the periphery, demonstrating that HCV can spread throughout the aggregates. ... interests The authors declare that they have no competing interests. Authors' contributions BS and VT participated in the design of the study, per- formed th...

Ngày tải lên : 12/08/2014, 04:22

8
642
0

Báo cáo khoa học: "SOFA is superior to MOD score for the determination of non-neurologic organ dysfunction in patients with severe traumatic brain injury: a cohort study" doc

... multisystem ICU patients [4,5]. In this cohort of patients, the proportion of patients with renal, hepatic, and hematologic failure was small. However, the pro- portions of patients with SOFA-defined ... component of the SOFA scoring system, as com- pared with 0.750 for the same component of the MOD scoring system. The difference was even more pronounced w...

Ngày tải lên : 13/08/2014, 02:24

10
388
0

Báo cáo khoa học: "Developing an Agrobacterium-mediated transformation system for Lilium x formolongo using thin cell layer of bulb scales" ppsx

... concentration on the growth of thin layers of bulb scale. Percentage of dead explants (%) Percentage of regeneration (%) PPT (mg/l) After 2 weeks After 4 weeks After 6 weeks After 2 weeks After ... immersed into the bacterial suspension for 30 min. They were then co- cultivated with Agrobacterium at 28 0 C for 7 days in the dark on the co-cultivation m...

Ngày tải lên : 06/08/2014, 19:20

6
343
0

Báo cáo khoa học: " Definitive radiotherapy and Single-Agent radiosensitizing Ifosfamide in Patients with localized, irresectable Soft Tissue Sarcoma: A retrospective analysis" pptx

... Thus, the complete regimen was given in 8/11 (73%) of the patients. Evaluation of skin toxicity was possible for 9 of the patients, 2 of which had severe reactions CTC grade III/ IV. Because of the ... problems after the first treatment. Additional che- motherapy with three courses of ifosfamide and epirubicin was administered after completion of radiochemot...

Ngày tải lên : 09/08/2014, 09:20

6
254
0