Báo cáo y học: " Multiple functions for CD28 and cytotoxic T lymphocyte antigen-4 during different phases of T cell responses: implications for arthritis and autoimmune disease" pot

Báo cáo y học: " Multiple functions for CD28 and cytotoxic T lymphocyte antigen-4 during different phases of T cell responses: implications for arthritis and autoimmune disease" pot

Báo cáo y học: " Multiple functions for CD28 and cytotoxic T lymphocyte antigen-4 during different phases of T cell responses: implications for arthritis and autoimmune disease" pot

... cell surface early after the Review Multiple functions for CD28 and cytotoxic T lymphocyte antigen-4 during different phases of T cell responses: implications for arthritis and autoimmune diseases Monika ... but also by the integration of the absence of positive costimulatory signals and the presence of negative costimulatory signals. CD28...

Ngày tải lên: 09/08/2014, 01:23

10 393 0
Báo cáo y học: "Relationship between psychosomatic complaints and circadian rhythm irregularity assessed by salivary levels of melatonin and growth hormone" ppsx

Báo cáo y học: "Relationship between psychosomatic complaints and circadian rhythm irregularity assessed by salivary levels of melatonin and growth hormone" ppsx

... settings, students with psychosomatic complaints often have chronotypic problems. For this reason, we investigated a potential connection between psychosomatic complaints and circadian rhythm ... Ministry of Education to Nagane M. Author details 1 Department of Educational Physiology, Faculty of Education, Chiba University, Japan. 2 Department of Physiology, Faculty of Medicine,...

Ngày tải lên: 10/08/2014, 09:20

6 444 0
Báo cáo y học: "Rho kinase inhibitors Y27632 and H1152 augment neurite extension in the presence of cultured Schwann cells" pdf

Báo cáo y học: "Rho kinase inhibitors Y27632 and H1152 augment neurite extension in the presence of cultured Schwann cells" pdf

... an important role in the axon and neurite extension through modulation of the RhoA pathway. In the unbound state, the p75NTR constitutively activates RhoA. When neuro- trophin binds to the p75NTR, ... of ROCK in a vari- ety of systems. This pyridine derivative is the oldest syn- thesised and reported specific inhibitor of Rho-kinase family enzymes. Y2 7632 inhibits ROCK activity...

Ngày tải lên: 10/08/2014, 10:20

11 485 0
Báo cáo y học: " Multiple shRNA combinations for near-complete coverage of all HIV-1 strains" potx

Báo cáo y học: " Multiple shRNA combinations for near-complete coverage of all HIV-1 strains" potx

... exhibiting greater suppressive activity than the guide strand. The activities for all combinations of 2 through to 7 cassettes were similar to each other and the activities of the most active single ... to test the combinations for their capacity to suppress the emergence of escape mutants over time, similar to other studies [11,16]. This is the critical assessment of activity t...

Ngày tải lên: 10/08/2014, 05:21

15 280 0
báo cáo hóa học:" Multiple functions of the von Willebrand Factor A domain in matrilins: secretion, assembly, and proteolysis" ppt

báo cáo hóa học:" Multiple functions of the von Willebrand Factor A domain in matrilins: secretion, assembly, and proteolysis" ppt

... TGC AGT GGT GGG TCA 17 TGT GGC TCT AAC GCA GAT TTT CAT TTG Amplifying mantn1 coiled-coil domain 18 ACT TGC TCA GCT GTC AGT GGT GGG TCA 19 TCT GGC TCT AAC GCA GAT TTT CAT TTG Amplifying mantn1 vWFA2 ... are important for the folding of the pro- tein structure [13]. It suggests that the secretion deficiency due to intracellular retention of the mutant protein, as demonstrated by this stud...

Ngày tải lên: 20/06/2014, 01:20

13 382 0
Báo cáo y học: "The anti-vaccination movement and resistance to allergen-immunotherapy: a guide for clinical allergists" ppt

Báo cáo y học: "The anti-vaccination movement and resistance to allergen-immunotherapy: a guide for clinical allergists" ppt

... to confer immunity.” “ allergy shots must stop a fter 3 to 5 years and at that time the doctor has to decide whether to con- tinue them or not. That would suggest that the cumulative effect of getting ... administration of costly allergy drugs that only transiently reduce symptoms (for instance, a recent study [31] demonstrated that immunotherapy-treated patients had significantly lowe...

Ngày tải lên: 08/08/2014, 21:20

11 582 0
Báo cáo y học: "Elevated extracellular matrix production and degradation upon bone morphogenetic protein-2 (BMP-2) stimulation point toward a role for BMP-2 in cartilage repair and remodeling" pps

Báo cáo y học: "Elevated extracellular matrix production and degradation upon bone morphogenetic protein-2 (BMP-2) stimulation point toward a role for BMP-2 in cartilage repair and remodeling" pps

... CCCCGAGGGCTGTGCTA TGAACTTCAACTGGAACAGGGTATC Aggrecan 0.992 2.15 TCTACCCCAACCAAACCGG AGGCATGGTGCTTTGACAGTG Collagen X 0.992 1.97 CACACTCTGTCCTCGTGCTTTG GGAATCCCTGTAAGACACACCAA Available online http:/ /arthritis- research.com/content/9/5/R102 Page ... GTTAGTGGGGTCTCGCTCCTG Collagen IA 0.997 2.10 TGACTGGAAGAGCGGAGAGTACT CCTTGATGGCGTCCAGGTT Collagen II 0.992 2.15 TTCCACTTCAGCTATGGCGA GACGTTAGCGGT...

Ngày tải lên: 09/08/2014, 10:21

11 401 0
Báo cáo y học: "Carotid intima-media thickness and endothelial function: useful surrogate markers for establishing cardiovascular risk in patients with inflammatory rheumatic disease" pdf

Báo cáo y học: "Carotid intima-media thickness and endothelial function: useful surrogate markers for establishing cardiovascular risk in patients with inflammatory rheumatic disease" pdf

... 47 patients with RA without clinically evident cardiovascular disease at the time of evaluation by carotid ultrasonography. In our study carotid IMT, categorized in quartiles, was strongly associated ... readers of this journal with an answer to this question. We recently reported [2] that carotid artery IMT had good ability to predict development of cardiovascular events over a 5-year...

Ngày tải lên: 09/08/2014, 10:23

2 249 0
Báo cáo y học: "Broad-range PCR, cloning and sequencing of the full 16S rRNA gene for detection of bacterial DNA in synovial fluid samples of Tunisian" pps

Báo cáo y học: "Broad-range PCR, cloning and sequencing of the full 16S rRNA gene for detection of bacterial DNA in synovial fluid samples of Tunisian" pps

... Systems, Inc, CA, USA). d HLA-B27 positivity was determined using a microcytotoxicity assay. Ct = Chlamydia trachomatis; RA = rheumatoid arthritis; ReA = reactive arthritis; OA = osteoarthritis; ... any bacterial DNA potentially present in the SF samples of patients with ReA, UA, and other forms of arthritis who were also ana- lyzed previously [15]. Materials and methods Patients...

Ngày tải lên: 09/08/2014, 14:22

11 462 0
w