Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer " pps

Báo cáo y học: " An ethnozoological study in the adjoining areas of Mount Abu wildlife sanctuary, India." docx

Báo cáo y học: " An ethnozoological study in the adjoining areas of Mount Abu wildlife sanctuary, India." docx

... 6:6 http://www.ethnobiomed.com/content/6/1/6 Page 6 of 8 The Garasiya tribe The Garasiya people are main inhabitant of surround- ings areas of the Mount Abu wildlife sanctuary, Pind- wara and Aburoad tehsil of Sirohi district of Rajasthan. Earlier ... animal origin by Garasiya people of Rajasthan. Methods The study area The Mount Abu wildlife sanctuary is located in...

Ngày tải lên: 10/08/2014, 09:20

8 550 0
Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps

Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps

... concen- tration at the cellular level, the advantage of gene transfer as a means of drug delivery arises from the sustained availability of IL-1Ra that this method permits. Materials and method Materials Ham’s ... potential of this mater- ial. Gene delivery may offer the greatest chance of early success. Recent data from our laboratory have shown that the synovia...

Ngày tải lên: 09/08/2014, 01:23

9 422 0
Báo cáo y học: "Quantitative ultrasound can assess the regeneration process of tissue-engineered cartilage using a complex between adherent bone marrow cells and a three-dimensional scaffold" docx

Báo cáo y học: "Quantitative ultrasound can assess the regeneration process of tissue-engineered cartilage using a complex between adherent bone marrow cells and a three-dimensional scaffold" docx

... bone marrow cells and a three-dimensional scaffold Koji Hattori 1 , Yoshinori Takakura 1 , Hajime Ohgushi 2 , Takashi Habata 1 , Kota Uematsu 1 , Jun Yamauchi 1 , Kenji Yamashita 3 , Takashi ... Masao Sato 3 and Ken Ikeuchi 4 1 Department of Orthopaedic Surgery, Nara Medical University, Nara, Japan 2 National Institute of Advanced Industrial Science and Technology, Amagasaki Site, Hy...

Ngày tải lên: 09/08/2014, 06:22

8 355 0
Báo cáo y học: "An MRI study on the relations between muscle atrophy, shoulder function and glenohumeral deformity in shoulders of children with obstetric brachial plexus injury" ppt

Báo cáo y học: "An MRI study on the relations between muscle atrophy, shoulder function and glenohumeral deformity in shoulders of children with obstetric brachial plexus injury" ppt

... form was related to infraspinatus muscle atrophy. Subluxation was related to both infraspinatus and subscapularis atrophy. There was no relation between atrophy of muscles and passive external ... anterior part of this line (AB) was divided by its total length (AC) and multiplied by 100. The normal value for this variable is approximately 50%[6] Statistics All data were collected an...

Ngày tải lên: 10/08/2014, 10:20

8 433 1
Báo cáo y học: " Early Anti-inflammatory and anti-arthritic effects of yucca schidigera: A review" pdf

Báo cáo y học: " Early Anti-inflammatory and anti-arthritic effects of yucca schidigera: A review" pdf

... portion of yuccaols A and B and trans-3,3',5,5'-tetrahydroxy-4'-methoxystilbene is the stil- bene in yuccaols C, D and E. By the analogy to the biosyn- thesis of larixinol it was presumed ... extraction. The chemistry and bioactivity of yucca saponins and phe- nolics have recently been reviewed by Piacente et al. [21]. Anti-arthritic effects of yucca Yuc...

Ngày tải lên: 11/08/2014, 08:21

7 369 0
Báo cáo Y học: Unique structural determinants in the signal peptides of ‘spontaneously’ inserting thylakoid membrane proteins pptx

Báo cáo Y học: Unique structural determinants in the signal peptides of ‘spontaneously’ inserting thylakoid membrane proteins pptx

... (iPsbW and sPsbW). For iPsbW, the forward and reverse primers were ATGGG TAAGAAGAAGGGAGGA and TCTCTTTGCTCGGA CGCG, respectively. For sPsbW, the forward and reverse primers were ATGGAGACAAAGCAAGGAAAC ... PsbY -A1 , the hydrophobicity of the C-domain is critical for correct maturation and negative charges in particular appear to be favored. In the case of PsbY -A2 , the negative...

Ngày tải lên: 18/03/2014, 01:20

11 484 0
Báo cáo y học: "Can physical activity improve the mental health of older adults" pps

Báo cáo y học: "Can physical activity improve the mental health of older adults" pps

... cancers. Delaying the clinical onset of AD by two years would reduce the total number of AD cases by approximately 600,000 in the USA alone [5]. Physical activity (PA) is often seen as an intervention ... months, particularly if they remain physically active during the follow-up period [32]. Finally, the results from the Almada County Study showed that physical activit...

Ngày tải lên: 08/08/2014, 20:23

5 544 0
Báo cáo y học: "Put your heart into the joint benefits of statins" pps

Báo cáo y học: "Put your heart into the joint benefits of statins" pps

... Therapy Vol 5 No 4 Hall The recognition that systemic inflammatory diseases are associated with accelerated atherosclerosis offers the prospect of reducing morbidity and mortality of affected patients ... it was reported that pravastatin decreased the incidence of haemodynamically significant rejection episodes in cardiac transplant patients and that this effect was independent o...

Ngày tải lên: 09/08/2014, 01:23

3 298 0
Báo cáo y học: " mRNA expression profiles show differential regulatory effects of microRNAs between estrogen receptor-positive and estrogen receptor-negative breast cancer" pdf

Báo cáo y học: " mRNA expression profiles show differential regulatory effects of microRNAs between estrogen receptor-positive and estrogen receptor-negative breast cancer" pdf

... GeneChips and one was measured by two-channel cDNA arrays (see Materials and methods for details about these datasets). For each dataset, we calculated the RE-scores of each miRNA in all samples. ... com- puted the Spearman correlation of the RE-scores and the ARR values for each microarray dataset. As illustrated in Table 2, the inhibitory activities calculated by these...

Ngày tải lên: 09/08/2014, 20:20

17 259 0
w