Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer " pps

... 6:6 http://www.ethnobiomed.com/content/6/1/6 Page 6 of 8 The Garasiya tribe The Garasiya people are main inhabitant of surround- ings areas of the Mount Abu wildlife sanctuary, Pind- wara and Aburoad tehsil of Sirohi district of Rajasthan. Earlier ... animal origin by Garasiya people of Rajasthan. Methods The study area The Mount Abu wildlife sanctuary is located in...

Ngày tải lên: 10/08/2014, 09:20

... concen- tration at the cellular level, the advantage of gene transfer as a means of drug delivery arises from the sustained availability of IL-1Ra that this method permits. Materials and method Materials Ham’s ... potential of this mater- ial. Gene delivery may offer the greatest chance of early success. Recent data from our laboratory have shown that the synovia...

Ngày tải lên: 09/08/2014, 01:23

... bone marrow cells and a three-dimensional scaffold Koji Hattori 1 , Yoshinori Takakura 1 , Hajime Ohgushi 2 , Takashi Habata 1 , Kota Uematsu 1 , Jun Yamauchi 1 , Kenji Yamashita 3 , Takashi ... Masao Sato 3 and Ken Ikeuchi 4 1 Department of Orthopaedic Surgery, Nara Medical University, Nara, Japan 2 National Institute of Advanced Industrial Science and Technology, Amagasaki Site, Hy...

Ngày tải lên: 09/08/2014, 06:22

... form was related to infraspinatus muscle atrophy. Subluxation was related to both infraspinatus and subscapularis atrophy. There was no relation between atrophy of muscles and passive external ... anterior part of this line (AB) was divided by its total length (AC) and multiplied by 100. The normal value for this variable is approximately 50%[6] Statistics All data were collected an...

Ngày tải lên: 10/08/2014, 10:20

Ngày tải lên: 10/08/2014, 10:20

... portion of yuccaols A and B and trans-3,3',5,5'-tetrahydroxy-4'-methoxystilbene is the stil- bene in yuccaols C, D and E. By the analogy to the biosyn- thesis of larixinol it was presumed ... extraction. The chemistry and bioactivity of yucca saponins and phe- nolics have recently been reviewed by Piacente et al. [21]. Anti-arthritic effects of yucca Yuc...

Ngày tải lên: 11/08/2014, 08:21

... (iPsbW and sPsbW). For iPsbW, the forward and reverse primers were ATGGG TAAGAAGAAGGGAGGA and TCTCTTTGCTCGGA CGCG, respectively. For sPsbW, the forward and reverse primers were ATGGAGACAAAGCAAGGAAAC ... PsbY -A1 , the hydrophobicity of the C-domain is critical for correct maturation and negative charges in particular appear to be favored. In the case of PsbY -A2 , the negative...

Ngày tải lên: 18/03/2014, 01:20

... cancers. Delaying the clinical onset of AD by two years would reduce the total number of AD cases by approximately 600,000 in the USA alone [5]. Physical activity (PA) is often seen as an intervention ... months, particularly if they remain physically active during the follow-up period [32]. Finally, the results from the Almada County Study showed that physical activit...

Ngày tải lên: 08/08/2014, 20:23

... Therapy Vol 5 No 4 Hall The recognition that systemic inflammatory diseases are associated with accelerated atherosclerosis offers the prospect of reducing morbidity and mortality of affected patients ... it was reported that pravastatin decreased the incidence of haemodynamically significant rejection episodes in cardiac transplant patients and that this effect was independent o...

Ngày tải lên: 09/08/2014, 01:23

... GeneChips and one was measured by two-channel cDNA arrays (see Materials and methods for details about these datasets). For each dataset, we calculated the RE-scores of each miRNA in all samples. ... com- puted the Spearman correlation of the RE-scores and the ARR values for each microarray dataset. As illustrated in Table 2, the inhibitory activities calculated by these...

Ngày tải lên: 09/08/2014, 20:20