Báo cáo y học: "Differentiation of naive CD4+ T cells towards T helper 2 cells is not impaired in rheumatoid arthritis patients" pps
Báo cáo y học: "Differentiation of naive CD4+ T cells towards T helper 2 cells is not impaired in rheumatoid arthritis patients" pps
... http:/ /arthritis- research.com/content/5/5/R269 R275 2. Panayi GS, Lanchbury JS, Kingsley GH: The importance of the T cell in initiating and maintaining the chronic synovitis of rheumatoid arthritis. Arthritis Rheum 19 92, 35: 729 -735. 3. Burmester ... tissue-destructive T- cell activity in rheumatoid arthritis (RA). The differentiation of naive CD4 + T cells in...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Association of cerebrospinal fluid anti-ribosomal P protein antibodies with diffuse psychiatric/neuropsychological syndromes in systemic lupus erythematosus" pps
... result from contamination of CSF anti- P C 22 in patients with SLE. These results indicate that autoanti- bodies directed against ribosomal P protein epitopes other than the C-terminal 22 -amino ... protein with IgG antibodies to car- boxyl-terminal 22 synthetic peptides and carboxyl-terminal 22 amino acid-depleted recombinant P0 fusion protein in patients with systemic lupus eryth...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "ACR70-disease activity score remission achievement from switches between all the available biological agents in rheumatoid arthritis: a systematic review of the literature" doc
... Burmester GR, on behalf of the Research in Active Rheumatoid Arthritis (ReAct) Study Group: Effectiveness of adalimumab for rheumatoid arthritis in patients with a history of TNF-antagonist therapy ... responses) in abatacept-treated patients who failed treatment with TNFα blockers In the Abatacept Trial in Treatment of Anti-TNF Inadequate Responders (ATTAIN), abat...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: " Ethnomedicine of the Kagera Region, north western Tanzania. Part 2: The medicinal plants used in Katoro Ward, Bukoba District" doc
... provided the information constituting this manuscript and their willingness to allow this information to be published. We thank the NAPRALERT Data base of the University of Illinois at Chicago ... medicine in Katoro ward of Bukoba district are well supported by literature, with 47% of the claims having already been reported. This study further enhances the validity of plants used...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: "High mobility group box-1 protein as a tumor necrosis factor-independent therapeutic target in rheumatoid arthritis." ppsx
... days. The induction of arthritis by rHMGB1 is primarily mediated by IL-1 as confirmed by the absence of arthritis in IL-1 receptor-deficient mice after rHMGB1 administration [7]. Systemic administration ... studies are required to further establish the relationship of HMGB1 and TNF in patients with RA. The present study supports the hypothesis that HMGB1 release is independe...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: " Differentiation of convulsive syncope from epilepsy with an implantable loop recorder Khalil Kanjwal, Beverly Karabin, Yousuf Kanjwal, Blair P Grubb"
... monitoring with an ILR may help identify those indi- viduals with a potentially treatable cardiac arrhyth- mic cause. Conflict of Interest The authors have declared that no conflict of in- terest ... were intermittent, occurring without any prodrome and were associated with convulsive activity. Episodes were associated with urinary in- continence and a post-ictal confusional stat...
Ngày tải lên: 26/10/2012, 09:53
Tài liệu Báo cáo Y học: Toxicity of substrate-bound amyloid peptides on vascular smooth muscle cells is enhanced by homocysteine docx
... suggest that Ab may activate apoptotic pathways to cause loss of VSMC in CAA by inhibiting cell–substrate interactions. Our studies also suggest that homocysteine, a known risk factor for other ... on plastic alone, indicating that cell–substrate adhesion may be important in maintaining cell viability. Ab also caused an increase in the number of apoptotic cells. This increase in...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo Y học: Expression of the uncoupling protein 1 from the aP2 gene promoter stimulates mitochondrial biogenesis in unilocular adipocytes in vivo potx
... effect of the transgene on in situ fatty acid synthesis i n t he two fat depots [20 ]. The results are in agreement with the hypothesis that induction of endogenous UCP1 acts locally, in c oncert ... ATGGGCCAATGTCCGCAGTGATGTC GGTGGCCTCTGATGCTTGCGTCGTCT AF098077 b-actin GAACCCTAAGGCCAACCGTGAAAAGAT ACCGCTCGTTGCCAATAGTGATG X03765 a The primers are speci®c for the isoform 1 of subun...
Ngày tải lên: 31/03/2014, 15:20
Báo cáo y học: "Infiltration of the synovial membrane with macrophage subsets and polymorphonuclear cells reflects global disease activity in spondyloarthropathy" pps
... and global disease activity in rheumatoid arthritis (RA) and the distinct but heterogeneous histology of spondyloarthropathy (SpA) synovitis, the present study analyzed whether histopathological features ... attempt to translate these histological findings into clinically relevant patterns, we assessed whether this heterogeneity was related to the fact that SpA consists of different...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Association of the diplotype configuration at the N-acetyltransferase 2 gene with adverse events with co-trimoxazole in Japanese patients with systemic lupus erythematosus" pps
... in the Japanese population, namely NAT2*4, NAT2*5B, NAT2*5E, NAT2*6A, NAT2*7B and NAT2*13. Of these, NAT2*4 is the wild-type haplotype; the remaining haplotypes are mutant types. In the present study, ... N-acetyltrans- ferase 2 (NAT2). In the pathogenesis of hypersensitivity, the formation of hydroxylamine through oxidization by cytochrome P450 and its subsequent autooxidatio...
Ngày tải lên: 09/08/2014, 10:20