Báo cáo y học: "Heterogeneity of CD4+ and CD8+ memory T cells in localized and generalized Wegener’s granulomatosis " potx

Báo cáo y học: "Heterogeneity of CD4+ and CD8+ memory T cells in localized and generalized Wegener’s granulomatosis." potx

Báo cáo y học: "Heterogeneity of CD4+ and CD8+ memory T cells in localized and generalized Wegener’s granulomatosis." potx

... Thus, the local cytokine milieu might depend on the site and extent of disease activity [4,5]. The shift in the cytokine profile in granuloma- tous lesions of the respiratory tract might be of ... on memory T cells might favor the recruitment of Th1-type effector memory T cells into granulomatous lesions of the respiratory tract, whereas in generalized WG the C...

Ngày tải lên: 09/08/2014, 01:21

7 355 0
Báo cáo y học: "Heterogeneity of autoantibodies in 100 patients with autoimmune myositis: insights into clinical features and outcomes" ppt

Báo cáo y học: "Heterogeneity of autoantibodies in 100 patients with autoimmune myositis: insights into clinical features and outcomes" ppt

... were detected in 6% and 3% of patients, respectively. Only anti-OJ and anti-EJ (both anti-synthetases) were not detected. Frequency of anti-synthetases and SSc autoantibodies Anti-synthetases ... associ- ated autoantibodies. Competing interests The authors declare that they have no competing interests. Authors' contributions JLS and MK participated in the design of the...

Ngày tải lên: 09/08/2014, 10:20

13 507 0
Báo cáo y học: " Heterogeneity of human effector CD4+ T cells" doc

Báo cáo y học: " Heterogeneity of human effector CD4+ T cells" doc

... [52]. The distinctive cytokine of murine Th17 cells, IL-17A, is involved in the recruitment, activation and migration of neutrophil granulocytes by inducing the production of colony- stimulatory ... antigen- presenting cell (APC), the cytokines present in the microenvironment created by the response of the innate immunity play a critical role in dictating the type of effect...

Ngày tải lên: 09/08/2014, 14:22

8 259 0
Báo cáo y học: "Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya"

Báo cáo y học: "Impact of the Kenya post-election crisis on clinic attendance and medication adherence for HIV-infected children in western Kenya"

... clinics were dramatically affected and others were scarcely affected. They further noted that the quantitative data did not adequately capture the bravery of the AMPATH patients or the AMPATH ... combination of existing infra- structure, cohesive and positive staff attitudes, and responsive efforts to find and care for patients may have improved continuity of clinical care and...

Ngày tải lên: 25/10/2012, 10:31

10 696 0
Tài liệu Báo cáo Y học: Proteolysis of bovine b-lactoglobulin during thermal treatment in subdenaturing conditions highlights some structural features of the temperature-modified protein and yields fragments with low immunoreactivity pptx

Tài liệu Báo cáo Y học: Proteolysis of bovine b-lactoglobulin during thermal treatment in subdenaturing conditions highlights some structural features of the temperature-modified protein and yields fragments with low immunoreactivity pptx

... and chymotrypsin gave the best results, both i n terms of interpretation of the hydrolysis pattern and o f r educed immunoreactivity [28]. Trypsin and chymotrypsin were used in the present study, ... act on complementary s ets of amino acids (hydrophobic, chymotrypsin; basic, trypsin). Other enzymes were tested, but their action was not further investigated in that they did no...

Ngày tải lên: 21/02/2014, 15:20

11 526 0
Báo cáo Y học: Properties of the Na+/H+ exchanger protein Detergent-resistant aggregation and membrane microdistribution potx

Báo cáo Y học: Properties of the Na+/H+ exchanger protein Detergent-resistant aggregation and membrane microdistribution potx

... and caveolin, confirming that methyl b-cyclodextrin was active. Surprisingly, we found that this treatment slightly stimulated NHE1 activity and was not inhibitory. We have recently shown that ... D to disrupt the cytoskeleton to determine if this would affect the distribution of the protein within lipid rafts. Cytochalasin D caused caveolin to be more widely distributed throughout the ....

Ngày tải lên: 08/03/2014, 16:20

9 433 0
Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot

Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot

... RNH2A-R; 5¢-ATAT GAA TTCTCTCTAAGGAGATATACTTAT GACCGTTTC CAA CATTGGG-3¢ for RNH2B-F; 5¢-GGGG AAGCTTCTA GTGGTGGTGGTGGTGGTGCTTACGTTTAAAAAAT CCATC-3¢ for RNH2B-R; 5¢-ATAT AAGCTTCTCTCAA GGAGATATACTTATGACCAAAGATGCCGTG-3¢ ... affinity. Binding analyses using BIAcore system To examine whether the mutation of Gly10 to Leu or Pro affects the substrate binding affinity of the protein, the interactions...

Ngày tải lên: 17/03/2014, 17:20

14 483 0
Báo cáo y học: "Heterogeneity of psychophysiological stress responses in fibromyalgia syndrome patients" pps

Báo cáo y học: "Heterogeneity of psychophysiological stress responses in fibromyalgia syndrome patients" pps

... comparison of patients with hypertension, rheumatoid arthritis, and systemic lupus erythematosus. As the sympathetic and parasympa- thetic response patterns are present in FMS as well, it may be that these ... patterns within the FMS sample. Materials and methods Participants Ninety female FMS patients recruited from a pain clinic, rheu- matology outpatient departments and a hospi...

Ngày tải lên: 09/08/2014, 07:20

10 335 0
Báo cáo y học: " Regulation of Sox9 activity by crosstalk with nuclear factor-κB and retinoic acid receptors" pptx

Báo cáo y học: " Regulation of Sox9 activity by crosstalk with nuclear factor-κB and retinoic acid receptors" pptx

... reduction in RAR activity when chondrocytes were treated with both TNF-α and atRA. Regulation of transcription factor activity by p300 Differences in the affinity for p300 may contribute to the ... activity. atRA inhibits binding of DNA by the TNF-α-activated complex To define further the inhibitory effect of atRA on NF-κB activity, we examined the effects of atRA on nuclear lo...

Ngày tải lên: 09/08/2014, 10:22

12 382 0
Báo cáo y học: " Effect of Ankaferd Blood Stopper on air leakage in the lung and prevention of bleeding: an experimental study" ppsx

Báo cáo y học: " Effect of Ankaferd Blood Stopper on air leakage in the lung and prevention of bleeding: an experimental study" ppsx

... in lobectomy, 3% in pneumonectomy [11]. The focus of hemorrhage cannot be determined in most of the cases. In the study of Sirbu et al. analyzing 1960 patients who underwent thoracotomy, they ... investigate the effect of this plant extract in the lung. Author details 1 Department of Thoracic Surgery, School of Medicine, University of Abant İzzet Baysal, Bolu, Turkey....

Ngày tải lên: 10/08/2014, 09:23

5 488 0
w